LDHA (NM_001135239) Human Untagged Clone

CAT#: SC325695

LDHA (untagged)-Human lactate dehydrogenase A (LDHA), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LDHA
• Synonyms: GSD11; HEL-S-133P; LDHM; PIG19
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001135239, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCAACTCTAAAGGATCAGCTGATTTATAATCTTCTAAAGGAAGAACAGACCCCCCAGAATAAGATTA
  CAGTTGTTGGGGTTGGTGCTGTTGGCATGGCCTGTGCCATCAGTATCTTAATGAAGGACTTGGCAGATGA
  ACTTGCTCTTGTTGATGTCATCGAAGACAAATTGAAGGGAGAGATGATGGATCTCCAACATGGCAGCCTT
  TTCCTTAGAACACCAAAGATTGTCTCTGGCAAAGTGGATATCTTGACCTACGTGGCTTGGAAGATAAGTG
  GTTTTCCCAAAAACCGTGTTATTGGAAGCGGTTGCAATCTGGATTCAGCCCGATTCCGTTACCTAATGGG
  GGAAAGGCTGGGAGTTCACCCATTAAGCTGTCATGGGTGGGTCCTTGGGGAACATGGAGATTCCAGTGTG
  CCTGTATGGAGTGGAATGAATGTTGCTGGTGTCTCTCTGAAGACTCTGCACCCAGATTTAGGGACTGATA
  AAGATAAGGAACAGTGGAAAGAGGTTCACAAGCAGGTGGTTGAGAGTGCTTATGAGGTGATCAAACTCAA
  AGGCTACACATCCTGGGCTATTGGACTCTCTGTAGCAGATTTGGCAGAGAGTATAATGAAGAATCTTAGG
  CGGGTGCACCCAGTTTCCACCATGATTAAGGGTCTTTACGGAATAAAGGATGATGTCTTCCTTAGTGTTC
  CTTGCATTTTGGGACAGAATGGAATCTCAGACCTTGTGAAGGTGACTCTGACTTCTGAGGAAGAGGCCCG
  TTTGAAGAAGAGTGCAGATACACTTTGGGGGATCCAAAAGGAGCTGCAATTTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001135239
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001135239.1, NP_001128711.1
• RefSeq Size: 2052 bp
• RefSeq ORF: 825 bp
• Locus ID: 3939
• Cytogenetics: 11p15.1
• Protein Families: Druggable Genome
• Protein Pathways: Cysteine and methionine metabolism, Glycolysis / Gluconeogenesis, Metabolic pathways, Propanoate metabolism, Pyruvate metabolism
• Gene Summary: 'The protein encoded by this gene catalyzes the conversion of L-lactate and NAD to pyruvate and NADH in the final step of anaerobic glycolysis. The protein is found predominantly in muscle tissue and belongs to the lactate dehydrogenase family. Mutations in this gene have been linked to exertional myoglobinuria. Multiple transcript variants encoding different isoforms have been found for this gene. The human genome contains several non-transcribed pseudogenes of this gene. [provided by RefSeq, Sep 2008]'
  Transcript Variant: This variant (2) lacks an in-frame exon in the central coding region, compared to variant 1. The resulting isoform (2) lacks a segment of the LDH domain but has the same N- and C-termini, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.