CISH (NM_013324) Human Untagged Clone

CAT#: SC325699

CISH (untagged)-Human cytokine inducible SH2-containing protein (CISH), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CISH
• Synonyms: BACTS2; CIS; CIS-1; G18; SOCS
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_013324, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTACCTAGAACACACCAGCCACTGTCCCCACCATGATGATGACACAGCCATGGACACACCCCTGCCCA
  GACCTCGTCCTTTGCTGGCTGTGGAGCGGACTGGGCAGCGGCCCCTGTGGGCCCCGTCCCTGGAACTGCC
  CAAGCCAGTCATGCAGCCCTTGCCTGCTGGGGCCTTCCTCGAGGAGGTGGCAGAGGGTACCCCAGCCCAG
  ACAGAGAGTGAGCCAAAGGTGCTGGACCCAGAGGAGGATCTGCTGTGCATAGCCAAGACCTTCTCCTACC
  TTCGGGAATCTGGCTGGTATTGGGGTTCCATTACGGCCAGCGAGGCCCGACAACACCTGCAGAAGATGCC
  AGAAGGCACGTTCTTAGTACGTGACAGCACGCACCCCAGCTACCTGTTCACGCTGTCAGTGAAAACCACT
  CGTGGCCCCACCAATGTACGCATTGAGTATGCCGACTCCAGCTTCCGTCTGGACTCCAACTGCTTGTCCA
  GGCCACGCATCCTGGCCTTTCCGGATGTGGTCAGCCTTGTGCAGCACTATGTGGCCTCCTGCACTGCTGA
  TACCCGAAGCGACAGCCCCGATCCTGCTCCCACCCCGGCCCTGCCTATGCCTAAGGAGGATGCGCCTAGT
  GACCCAGCACTGCCTGCTCCTCCACCAGCCACTGCTGTACACCTAAAACTGGTGCAGCCCTTTGTACGCA
  GAAGCAGTGCCCGCAGCCTGCAACACCTGTGCCGCCTTGTCATCAACCGTCTGGTGGCCGACGTGGACTG
  CCTGCCACTGCCCCGGCGCATGGCCGACTACCTCCGACAGTACCCCTTCCAGCTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_013324
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_013324.5, NP_037456.5
• RefSeq Size: 2285 bp
• RefSeq ORF: 828 bp
• Locus ID: 1154
• Cytogenetics: 3p21.2
• Domains: SH2, SOCS
• Protein Families: Druggable Genome
• Protein Pathways: Jak-STAT signaling pathway
• Gene Summary: 'The protein encoded by this gene contains a SH2 domain and a SOCS box domain. The protein thus belongs to the cytokine-induced STAT inhibitor (CIS), also known as suppressor of cytokine signaling (SOCS) or STAT-induced STAT inhibitor (SSI), protein family. CIS family members are known to be cytokine-inducible negative regulators of cytokine signaling. The expression of this gene can be induced by IL2, IL3, GM-CSF and EPO in hematopoietic cells. Proteasome-mediated degradation of this protein has been shown to be involved in the inactivation of the erythropoietin receptor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]'
  Transcript Variant: This variant (1) represents a longer transcript, and encodes an isoform (1) with a distinct N-terminus.