FAIM3 (FCMR) (NM_001142473) Human Untagged Clone

CAT#: SC325703

FAIM3 (untagged)-Human Fas apoptotic inhibitory molecule 3 (FAIM3), transcript variant 3


  "NM_001142473" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "FCMR"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FCMR
Synonyms FAIM3; TOSO
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001142473, the custom clone sequence may differ by one or more nucleotides


ATGGACTTCTGGCTTTGGCCACTTTACTTCCTGCCAGAATACGAGCCATCATGGGAAGAGCAGCCAATGC
CTGAGACTCCAAAATGGTTTCATCTGCCCTATTTGTTCCAGATGCCTGCATATGCCAGTTCTTCCAAATT
CGTAACCAGAGTTACCACACCAGCTCAAAGGGGCAAGGTCCCTCCAGTTCACCACTCCTCCCCCACCACC
CAAATCACCCACCGCCCTCGAGTGTCCAGAGCATCTTCAGTAGCAGGTGACAAGCCCCGAACCTTCCTGC
CATCCACTACAGCCTCAAAAATCTCAGCTCTGGAGGGGCTGCTCAAGCCCCAGACGCCCAGCTACAACCA
CCACACCAGGCTGCACAGGCAGAGAGCACTGGACTATGGCTCACAGTCTGGGAGGGAAGGCCAAGGATTT
CACATCCTGATCCCGACCATCCTGGGCCTTTTCCTGCTGGCACTTCTGGGGCTGGTGGTGAAAAGGGCCG
TTGAAAGGAGGAAAGCCCTCTCCAGGCGGGCCCGCCGACTGGCCGTGAGGATGCGCGCCCTGGAGAGCTC
CCAGAGGCCCCGCGGGTCGCCGCGACCGCGCTCCCAAAACAACATCTACAGCGCCTGCCCGCGGCGCGCT
CGTGGAGCGGACGCTGCAGGCACAGGGGAGGCCCCCGTTCCCGGCCCCGGAGCGCCGTTGCCCCCCGCCC
CGCTGCAGGTGTCTGAATCTCCCTGGCTCCATGCCCCATCTCTGAAGACCAGCTGTGAATACGTGAGCCT
CTACCACCAGCCTGCCGCCATGATGGAGGACAGTGATTCAGATGACTACATCAATGTTCCTGCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001142473
ORF Size 837 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001142473.1, NP_001135945.1
RefSeq Size 2773
RefSeq ORF 837
Locus ID 9214
Protein Families Druggable Genome, Transmembrane
Gene Summary Fc receptors specifically bind to the Fc region of immunoglobulins (Igs) to mediate the unique functions of each Ig class. FAIM3 encodes an Fc receptor for IgM (see MIM 147020) (Kubagawa et al., 2009 [PubMed 19858324]; Shima et al., 2010 [PubMed 20042454]). [supplied by OMIM, Jul 2010]
Transcript Variant: This variant (3) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform b), compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.