PPHLN1 (NM_001143789) Human Untagged Clone
CAT#: SC325724
PPHLN1 (untagged)-Human periphilin 1 (PPHLN1), transcript variant 8
"NM_001143789" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PPHLN1 |
Synonyms | CR; HSPC206; HSPC232 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001143789, the custom clone sequence may differ by one or more nucleotides
ATGTGGTCTGAGGGACGATATGAATATGAAAGAATTCCGAGAGAACGAGCACCTCCTCGAAGTCATCCCA GTGATGAATCTGGTTATAGATGGACAAGAGACGATCATTCTGCAAGCAGGCAACCTGAATACAGGGACAT GAGAGATGGCTTTAGAAGAAAAAGTTTCTACTCTTCCCATTATGCGAGAGAGCGGTCTCCTTATAAAAGG GACAATACTTTTTTCAGAGAATCACCTGTTGGCCGAAAGGATTCTCCACACAGCAGATCTGGTTCCAGTG TCAGTAGCAGAAGCTACTCTCCAGAAAGGAGCAAATCATACTCTTTCCATCAGTCTCAACATAGAAATAA AGAGAGGCCTGTCCAGTCTTTGAAAACATCAAGAGATACTTCACCCTCAAGTGGTTCAGCAGTTTCTTCA TCAAAGGTGTTAGACAAACCCAGTAGGCTAACTGAAAAGGAACTTGCTGAGGCTGCAAGCAAGTGGGCTG CTGAAAAGCTAGAGAAATCAGATGAAAGTAACTTGCCTGAAATTTCTGAGTATGAGGCGGGATCCACAGC ACCATTGTTTACTGACCAGCCAGAGGAACCTGAGTCAAACACAACACATGGGATAGAATTATTTGAAGAT AGTCAGCTAACCACTCGCTCTAAAGCAATAGCATCAAAAACCAAAGAGATTGAACAGGTTTACCGACAAG ACTGTGAAACTTTCGGGATGGTGGTGAAAATGCTGATTGAAAAAGATCCTTCATTAGAAAAGTCTATACA GTTTGCATTGAGGCAGAATTTACATGAAATAGGTGAGCGGTGTGTTGAAGAACTCAAGCATTTCATTGCA GAGTATGATACTTCCACTCAAGATTTTGGAGAGCCTTTTTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001143789 |
ORF Size | 882 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001143789.1, NP_001137261.1 |
RefSeq Size | 1455 |
RefSeq ORF | 882 |
Locus ID | 51535 |
Gene Summary | The protein encoded by this gene is one of the several proteins that become sequentially incorporated into the cornified cell envelope during the terminal differentiation of keratinocyte at the outer layers of epidermis. This protein interacts with periplakin, which is known as a precursor of the cornified cell envelope. The cellular localization pattern and insolubility of this protein suggest that it may play a role in epithelial differentiation and contribute to epidermal integrity and barrier formation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (8) lacks two alternate in-frame exons and has multiple differences in the 3' region when compared to variant 1. The resulting isoform (8) has a distinct and shorter C-terminus and lacks two internal segments compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227699 | PPHLN1 (Myc-DDK-tagged)-Human periphilin 1 (PPHLN1), transcript variant 8 |
USD 420.00 |
|
RG227699 | PPHLN1 (GFP-tagged) - Human periphilin 1 (PPHLN1), transcript variant 8 |
USD 460.00 |
|
RC227699L3 | Lenti ORF clone of Human periphilin 1 (PPHLN1), transcript variant 8, Myc-DDK-tagged |
USD 620.00 |
|
RC227699L4 | Lenti ORF clone of Human periphilin 1 (PPHLN1), transcript variant 8, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review