PPHLN1 (NM_001143789) Human Untagged Clone

CAT#: SC325724

PPHLN1 (untagged)-Human periphilin 1 (PPHLN1), transcript variant 8

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PPHLN1
• Synonyms: CR; HSPC206; HSPC232
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001143789, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTGGTCTGAGGGACGATATGAATATGAAAGAATTCCGAGAGAACGAGCACCTCCTCGAAGTCATCCCA
  GTGATGAATCTGGTTATAGATGGACAAGAGACGATCATTCTGCAAGCAGGCAACCTGAATACAGGGACAT
  GAGAGATGGCTTTAGAAGAAAAAGTTTCTACTCTTCCCATTATGCGAGAGAGCGGTCTCCTTATAAAAGG
  GACAATACTTTTTTCAGAGAATCACCTGTTGGCCGAAAGGATTCTCCACACAGCAGATCTGGTTCCAGTG
  TCAGTAGCAGAAGCTACTCTCCAGAAAGGAGCAAATCATACTCTTTCCATCAGTCTCAACATAGAAATAA
  AGAGAGGCCTGTCCAGTCTTTGAAAACATCAAGAGATACTTCACCCTCAAGTGGTTCAGCAGTTTCTTCA
  TCAAAGGTGTTAGACAAACCCAGTAGGCTAACTGAAAAGGAACTTGCTGAGGCTGCAAGCAAGTGGGCTG
  CTGAAAAGCTAGAGAAATCAGATGAAAGTAACTTGCCTGAAATTTCTGAGTATGAGGCGGGATCCACAGC
  ACCATTGTTTACTGACCAGCCAGAGGAACCTGAGTCAAACACAACACATGGGATAGAATTATTTGAAGAT
  AGTCAGCTAACCACTCGCTCTAAAGCAATAGCATCAAAAACCAAAGAGATTGAACAGGTTTACCGACAAG
  ACTGTGAAACTTTCGGGATGGTGGTGAAAATGCTGATTGAAAAAGATCCTTCATTAGAAAAGTCTATACA
  GTTTGCATTGAGGCAGAATTTACATGAAATAGGTGAGCGGTGTGTTGAAGAACTCAAGCATTTCATTGCA
  GAGTATGATACTTCCACTCAAGATTTTGGAGAGCCTTTTTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001143789
• ORF Size: 882 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001143789.1, NP_001137261.1
• RefSeq Size: 1455
• RefSeq ORF: 882
• Locus ID: 51535
• Gene Summary: The protein encoded by this gene is one of the several proteins that become sequentially incorporated into the cornified cell envelope during the terminal differentiation of keratinocyte at the outer layers of epidermis. This protein interacts with periplakin, which is known as a precursor of the cornified cell envelope. The cellular localization pattern and insolubility of this protein suggest that it may play a role in epithelial differentiation and contribute to epidermal integrity and barrier formation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (8) lacks two alternate in-frame exons and has multiple differences in the 3' region when compared to variant 1. The resulting isoform (8) has a distinct and shorter C-terminus and lacks two internal segments compared to isoform 1.