ALG5 (NM_001142364) Human Untagged Clone

CAT#: SC325725

ALG5 (untagged)-Human asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae) (ALG5), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ALG5
• Synonyms: bA421P11.2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001142364, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTCCGCTTCTGTTGCAGCTGGCGGTGCTCGGCGCGGCGCTGGCGGCCGCAGCCCTCGTACTGATTT
  CCATCGTTGCATTTACAACTGCTACAAAAATGCCAGCACTCCATCGACATGAAGAAGAGAAATTCTTCTT
  AAATGCCAAAGGCCAGAAAGAAACTTTACCCAGCATATGGGACTCACCTACCAAACAACTTTCTGTCGTT
  GTGCCTTCATACAATGAAGAAAAACGGTTGCCTGTGATGATGGATGAAGCTCTGAGCTATCTAGAGAAGA
  GACAGAAATATGGAAGTGACAAAGTACGTGTGATAACCCTGGTGAAGAATCGTGGAAAAGGTGGAGCGAT
  TAGAATGGGTATATTCAGTTCTCGAGGAGAAAAGATCCTTATGGCAGATGCTGATGGAGCCACAAAGTTT
  CCAGATGTTGAGAAATTAGAAAAGGGGCTAAATGATCTACAGCCTTGGCCTAATCAAATGGCTATAGCAT
  GTGGATCTCGAGCTCATTTAGAAAAAGAATCAATTGCTCAGCGTTCTTACTTCCGTACTCTTCTCATGTA
  TGGGTTCCACTTTCTGGTGTGGTTCCTTTGTGTCAAAGGAATCAGGGACACACAGTGTGGGTTCAAATTA
  TTTACTCGAGAAGCAGCTTCACGGACGTTTTCATCTCTACACGTTGAACGATGGGCATTTGATGTAGAAC
  TACTGTACATAGCACAGTTCTTTAAAATTCCAATAGCAGAAATTGCTGTCAACTGGACAGAAATTGAAGG
  TTCTAAATTAGTTCCATTCTGGAGCTGGCTACAAATGGGTAAAGACCTACTTTTTATACGACTTCGATAT
  TTGACTGGTGCCTGGAGGCTTGAGCAAACTCGGAAAATGAATTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001142364
• ORF Size: 885 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001142364.1, NP_001135836.1
• RefSeq Size: 1137
• RefSeq ORF: 885
• Locus ID: 29880
• Protein Families: Transmembrane
• Protein Pathways: Metabolic pathways, N-Glycan biosynthesis
• Gene Summary: This gene encodes a member of the glycosyltransferase 2 family. The encoded protein participates in glucosylation of the oligomannose core in N-linked glycosylation of proteins. The addition of glucose residues to the oligomannose core is necessary to ensure substrate recognition, and therefore, effectual transfer of the oligomannose core to the nascent glycoproteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter than isoform 1.