HDAC11 (NM_001136041) Human Untagged Clone
CAT#: SC325730
HDAC11 (untagged)-Human histone deacetylase 11 (HDAC11), transcript variant 2
"NM_001136041" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HDAC11 |
Synonyms | HD11 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001136041, the custom clone sequence may differ by one or more nucleotides
ATGGGCCTGGAGAAGCTGCATCCCTTTGATGCCGGAAAATGGGGCAAAGTGATCAATTTCCTAAAAGAAG AGAAGCTTCTGTCTGACAGCATGCTGGTGGAGGCGCGGGAGGCCTCGGAGGAGGACCTGCTGGTGGTGCA CACGAGGCGCTATCTTAATGAGCTCAAGAGGAAGGTGCTGAGGCCCCTTCGGACCCAGACAGGAGGAACC ATAATGGCGGGGAAGCTGGCTGTGGAGCGAGGCTGGGCCATCAACGTGGGGGGTGGCTTCCACCACTGCT CCAGCGACCGTGGCGGGGGCTTCTGTGCCTATGCGGACATCACGCTCGCCATCAAGTTTCTGTTTGAGCG TGTGGAGGGCATCTCCAGGGCTACCATCATTGATCTTGATGCCCATCAGGGCAATGGGCATGAGCGAGAC TTCATGGACGACAAGCGTGTGTACATCATGGATGTCTACAACCGCCACATCTACCCAGGGGACCGCTTTG CCAAGCAGGCCATCAGGCGGAAGGTGGAGCTGGAGTGGGGCACAGAGGATGATGAGTACCTGGATAAGGT GGAGAGGAACATCAAGAAATCCCTCCAGGAGCACCTGCCCGACGTGGTGGTATACAATGCAGGCACCGAC ATCCTCGAGGGGGACCGCCTTGGGGGGCTGTCCATCAGCCCAGCGGGCATCGTGAAGCGGGATGAGCTGG TGTTCCGGATGGTCCGTGGCCGCCGGGTGCCCATCCTTATGGTGACCTCAGGCGGGTACCAGAAGCGCAC AGCCCGCATCATTGCTGACTCCATACTTAATCTGTTTGGCCTGGGGCTCATTGGGCCTGAGTCACCCAGC GTCTCCGCACAGAACTCAGACACACCGCTGCTTCCCCCTGCAGTGCCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001136041 |
ORF Size | 891 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001136041.2, NP_001129513.1 |
RefSeq Size | 2817 |
RefSeq ORF | 891 |
Locus ID | 79885 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | This gene encodes a class IV histone deacetylase. The encoded protein is localized to the nucleus and may be involved in regulating the expression of interleukin 10. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009] Transcript Variant: This variant (2) differs in the 5' UTR and coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227612 | HDAC11 (Myc-DDK-tagged)-Human histone deacetylase 11 (HDAC11), transcript variant 2 |
USD 420.00 |
|
RG227612 | HDAC11 (GFP-tagged) - Human histone deacetylase 11 (HDAC11), transcript variant 2 |
USD 460.00 |
|
RC227612L3 | Lenti ORF clone of Human histone deacetylase 11 (HDAC11), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC227612L4 | Lenti ORF clone of Human histone deacetylase 11 (HDAC11), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review