HDAC11 (NM_001136041) Human Untagged Clone

CAT#: SC325730

HDAC11 (untagged)-Human histone deacetylase 11 (HDAC11), transcript variant 2


  "NM_001136041" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "HDAC11"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HDAC11
Synonyms HD11
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001136041, the custom clone sequence may differ by one or more nucleotides


ATGGGCCTGGAGAAGCTGCATCCCTTTGATGCCGGAAAATGGGGCAAAGTGATCAATTTCCTAAAAGAAG
AGAAGCTTCTGTCTGACAGCATGCTGGTGGAGGCGCGGGAGGCCTCGGAGGAGGACCTGCTGGTGGTGCA
CACGAGGCGCTATCTTAATGAGCTCAAGAGGAAGGTGCTGAGGCCCCTTCGGACCCAGACAGGAGGAACC
ATAATGGCGGGGAAGCTGGCTGTGGAGCGAGGCTGGGCCATCAACGTGGGGGGTGGCTTCCACCACTGCT
CCAGCGACCGTGGCGGGGGCTTCTGTGCCTATGCGGACATCACGCTCGCCATCAAGTTTCTGTTTGAGCG
TGTGGAGGGCATCTCCAGGGCTACCATCATTGATCTTGATGCCCATCAGGGCAATGGGCATGAGCGAGAC
TTCATGGACGACAAGCGTGTGTACATCATGGATGTCTACAACCGCCACATCTACCCAGGGGACCGCTTTG
CCAAGCAGGCCATCAGGCGGAAGGTGGAGCTGGAGTGGGGCACAGAGGATGATGAGTACCTGGATAAGGT
GGAGAGGAACATCAAGAAATCCCTCCAGGAGCACCTGCCCGACGTGGTGGTATACAATGCAGGCACCGAC
ATCCTCGAGGGGGACCGCCTTGGGGGGCTGTCCATCAGCCCAGCGGGCATCGTGAAGCGGGATGAGCTGG
TGTTCCGGATGGTCCGTGGCCGCCGGGTGCCCATCCTTATGGTGACCTCAGGCGGGTACCAGAAGCGCAC
AGCCCGCATCATTGCTGACTCCATACTTAATCTGTTTGGCCTGGGGCTCATTGGGCCTGAGTCACCCAGC
GTCTCCGCACAGAACTCAGACACACCGCTGCTTCCCCCTGCAGTGCCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001136041
ORF Size 891 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001136041.2, NP_001129513.1
RefSeq Size 2817
RefSeq ORF 891
Locus ID 79885
Protein Families Druggable Genome, Transcription Factors
Gene Summary This gene encodes a class IV histone deacetylase. The encoded protein is localized to the nucleus and may be involved in regulating the expression of interleukin 10. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Transcript Variant: This variant (2) differs in the 5' UTR and coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.