SLC8A3 (NM_001130417) Human Untagged Clone

CAT#: SC325736

SLC8A3 (untagged)-Human solute carrier family 8 (sodium/calcium exchanger), member 3 (SLC8A3), transcript variant g

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SLC8A3
• Synonyms: NCX3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001130417, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAACGTGGAATATCAGATGTGACAGACAGGAAGCTGACTATGGAAGAAGAGGAGGCCAAGAGGATAG
  CAGAGATGGGAAAGCCAGTATTGGGTGAACACCCCAAACTAGAAGTCATCATTGAAGAGTCCTATGAGTT
  CAAGACTACGGTGGACAAACTGATCAAGAAGACAAACCTGGCCTTGGTTGTGGGGACCCATTCCTGGAGG
  GACCAGTTCATGGAGGCCATCACCGTCAGTGCAGCAGGGGATGAGGATGAGGATGAATCCGGGGAGGAGA
  GGCTGCCCTCCTGCTTTGACTACGTCATGCACTTCCTGACTGTCTTCTGGAAGGTGCTGTTTGCCTGTGT
  GCCCCCCACAGAGTACTGCCACGGCTGGGCCTGCTTCGCCGTCTCCATCCTCATCATTGGCATGCTCACC
  GCCATCATTGGGGACCTGGCCTCGCACTTCGGCTGCACCATTGGTCTCAAAGATTCAGTCACAGCTGTTG
  TTTTCGTGGCATTTGGCACCTCTGTCCCAGATACGTTTGCCAGCAAAGCTGCTGCCCTCCAGGATGTATA
  TGCAGACGCCTCCATTGGCAACGTGACGGGCAGCAACGCCGTCAATGTCTTCCTGGGCATCGGCCTGGCC
  TGGTCCGTGGCCGCCATCTACTGGGCTCTGCAGGGACAGGAGTTCCACGTGTCGGCCGGCACACTGGCCT
  TCTCCGTCACCCTCTTCACCATCTTTGCATTTGTCTGCATCAGCGTGCTCTTGTACCGAAGGCGGCCGCA
  CCTGGGAGGGGAGCTTGGTGGCCCCCGTGGCTGCAAGCTCGCCACAACATGGCTCTTTGTGAGCCTGTGG
  CTCCTCTACATACTCTTTGCCACACTAGAGGCCTATTGCTACATCAAGGGGTTCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001130417
• ORF Size: 897 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001130417.2, NP_001123889.1
• RefSeq Size: 2979
• RefSeq ORF: 897
• Locus ID: 6547
• Protein Families: Transmembrane
• Protein Pathways: Calcium signaling pathway
• Gene Summary: This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
  Transcript Variant: This variant (g, also known as NCX3-tN.2) differs in the presence and absence of exons at its 5' end, compared to variant c. These differences result in a distinct 5' UTR and translation initiation at a downstream start codon, and an isoform (G) that is shorter than isoform C.