HRH4 (NM_001143828) Human Untagged Clone

CAT#: SC325741

HRH4 (untagged)-Human histamine receptor H4 (HRH4), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HRH4
• Synonyms: AXOR35; BG26; GPCR105; GPRv53; H4; H4R; HH4R
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001143828, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCAGATACTAATAGCACAATCAATTTATCACTAAGCACTCGTGTTACTTTAGCATTTTTTATGTCCT
  TAGTAGCTTTTGCTATAATGCTAGGAAATGCTTTGGTCATTTTAGCTTTTGTGGTGGACAAAAACCTTAG
  ACATCGAAGTAGTTATTTTTTTCTTAACTTGGCCATCTCTGACTTCTTTGTGGTTTCAGAGTCTTGGAAG
  GATGAAGGTAGTGAATGTGAACCTGGATTTTTTTCGGAATGGTACATCCTTGCCATCACATCATTCTTGG
  AATTCGTGATCCCAGTCATCTTAGTCGCTTATTTCAACATGAATATTTATTGGAGCCTGTGGAAGCGTGA
  TCATCTCAGTAGGTGCCAAAGCCATCCTGGACTGACTGCTGTCTCTTCCAACATCTGTGGACACTCATTC
  AGAGGTAGACTATCTTCAAGGAGATCTCTTTCTGCATCGACAGAAGTTCCTGCATCCTTTCATTCAGAGA
  GACAGAGGAGAAAGAGTAGTCTCATGTTTTCCTCAAGAACCAAGATGAATAGCAATACAATTGCTTCCAA
  AATGGGTTCCTTCTCCCAATCAGATTCTGTAGCTCTTCACCAAAGGGAACATGTTGAACTGCTTAGAGCC
  AGGAGATTAGCCAAGTCACTGGCCATTCTCTTAGGGGTTTTTGCTGTTTGCTGGGCTCCATATTCTCTGT
  TCACAATTGTCCTTTCATTTTATTCCTCAGCAACAGGTCCTAAATCAGTTTGGTATAGAATTGCATTTTG
  GCTTCAGTGGTTCAATTCCTTTGTCAATCCTCTTTTGTATCCATTGTGTCACAAGCGCTTTCAAAAGGCT
  TTCTTGAAAATATTTTGTATAAAAAAGCAACCTCTACCATCACAACACAGTCGGTCAGTATCTTCTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001143828
• ORF Size: 909 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001143828.1, NP_001137300.1
• RefSeq Size: 3422
• RefSeq ORF: 909
• Locus ID: 59340
• Protein Families: Druggable Genome, GPCR, Transmembrane
• Protein Pathways: Neuroactive ligand-receptor interaction
• Gene Summary: Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by a family of histamine receptors, which are a subset of the G-protein coupled receptor superfamily. This gene encodes a histamine receptor that is predominantly expressed in haematopoietic cells. The protein is thought to play a role in inflammation and allergy reponses. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
  Transcript Variant: This variant (2) has multiple differences in the coding region but maintains the reading frame, compared to variant 1. This variant encodes isoform 2, also known as H4R(302), which is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.