Syntaxin 16 (STX16) (NM_001134773) Human Untagged Clone
CAT#: SC325749
STX16 (untagged)-Human syntaxin 16 (STX16), transcript variant 4
"NM_001134773" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | STX16 |
Synonyms | SYN16 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001134773, the custom clone sequence may differ by one or more nucleotides
ATGGCCACCAGGCGTTTAACCGACGCTTTCTTGTTGTTGCGGAATAATTCCATCCAAAACCGGCAGCTGT TAGCCGAGCAAGAGCTGGACGAGCTTGCTGATGACCGTATGGCACTGGTGTCAGGCATCAGCTTAGATCC AGAAGCAGCGATTGGTGTGACAAAACGGCCACCTCCTAAGTGGGTGGATGGAGTGGATGAAATTCAGTAT GATGTTGGCCGGATTAAGCAGAAGATGAAAGAATTGGCCAGCCTTCATGACAAGCATTTAAACAGACCCA CCCTGGATGACAGCAGCGAAGAGGAACATGCCATTGAGATAACTACCCAAGAGATCACTCAGCTCTTCCA CAGGTGCCAGCGTGCCGTGCAGGCCCTGCCGAGCCGGGCCCGGGCCTGCTCCGAGCAGGAGGGGCGGCTG CTTGGGAACGTGGTGGCCTCGCTGGCGCAGGCCCTGCAGGAACTCTCCACCAGCTTCCGGCACGCACAGT CAGGCTACCTCAAACGCATGAAGAATCGAGAGGAAAGATCCCAGCATTTTTTCGACACATCAGTACCACT AATGGATGATGGAGACGATAACACTCTTTACCATCGGGGTTTTACAGAGGACCAGTTAGTTCTGGTGGAG CAGAACACACTGATGGTGGAAGAGCGGGAACGAGAGATTCGCCAGATTGTACAGTCCATTTCTGACCTGA ATGAAATATTCAGGGACTTAGGGGCGATGATTGTAGAACAGGGTACAGTCCTTGACAGAATTGACTATAA CGTTGAACAGTCCTGTATCAAAACTGAAGATGGTTTGAAACAGCTTCACAAGGCAGAACAGTATCAAAAG AAGAATCGGAAGATGCTTGTGATTTTAATATTATTTGTCATCATCATTGTGCTCATTGTTGTCCTCGTTG GCGTGAAGTCTCGATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001134773 |
ORF Size | 927 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001134773.2, NP_001128245.1 |
RefSeq Size | 4927 |
RefSeq ORF | 927 |
Locus ID | 8675 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | SNARE interactions in vesicular transport |
Gene Summary | This gene encodes a protein that is a member of the syntaxin or t-SNARE (target-SNAP receptor) family. These proteins are found on cell membranes and serve as the targets for V-SNARES (vesicle-SNAP receptors) permitting specific synaptic vesicle docking and fusion. A microdeletion in the region of chromosome 20 where this gene is located has been associated with pseudohypoparathyroidism type Ib. Multiple transcript variants have been found for this gene. Read-through transcription also exists between this gene and the neighboring downstream aminopeptidase-like 1 (NPEPL1) gene. [provided by RefSeq, Mar 2011] Transcript Variant: This variant (4) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1, resulting in a shorter isoform (d), compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225432 | STX16 (Myc-DDK-tagged)-Human syntaxin 16 (STX16), transcript variant 4 |
USD 420.00 |
|
RG225432 | STX16 (GFP-tagged) - Human syntaxin 16 (STX16), transcript variant 4 |
USD 460.00 |
|
RC225432L3 | Lenti ORF clone of Human syntaxin 16 (STX16), transcript variant 4, Myc-DDK-tagged |
USD 620.00 |
|
RC225432L4 | Lenti ORF clone of Human syntaxin 16 (STX16), transcript variant 4, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review