EB2 (MAPRE2) (NM_001143827) Human Untagged Clone

CAT#: SC325758

MAPRE2 (untagged)-Human microtubule-associated protein, RP/EB family, member 2 (MAPRE2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MAPRE2
• Synonyms: CSCSC2; EB1; EB2; RP1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001143827, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAACAGAACAGAGATCAAAAGTGTCCTGTTTCCCAGAGGAACAGTTCATTTCAACAGCCAGGGAGAA
  AGCCTGGATGCTCAAGTTGGGGAATGGCGGTCAATGTGTATTCTACCTCGATAACCCAAGAGACTATGAG
  CAGACATGACATCATTGCATGGGTTAATGACATAGTATCTTTAAACTACACAAAAGTGGAACAGCTTTGT
  TCAGGAGCGGCCTATTGCCAATTCATGGACATGCTCTTCCCTGGCTGCATTAGTTTGAAGAAAGTAAAAT
  TTCAAGCAAAGCTGGAACATGAATATATTCACAATTTTAAACTTCTGCAAGCATCATTTAAGCGAATGAA
  CGTTGATAAGGTAATTCCAGTGGAGAAGCTAGTGAAAGGACGTTTCCAGGACAACCTGGATTTTATTCAA
  TGGTTTAAGAAATTCTATGATGCTAACTACGATGGGAAGGAGTATGATCCTGTAGAGGCACGACAAGGGC
  AAGATGCAATTCCTCCTCCTGACCCTGGTGAACAGATCTTCAACCTGCCAAAAAAGTCTCACCATGCAAA
  CTCCCCCACAGCAGGTGCAGCTAAATCAAGTCCAGCAGCTAAACCAGGATCCACACCTTCTCGACCCTCA
  TCAGCCAAAAGGGCTTCTTCCAGTGGCTCAGCATCCAAATCCGATAAAGATTTAGAAACGCAGGTCATAC
  AGCTTAATGAACAGGTACATTCATTAAAACTTGCCCTTGAAGGCGTGGAAAAGGAAAGGGATTTCTACTT
  TGGGAAGTTGAGAGAGATCGAGCTACTCTGCCAAGAACACGGGCAGGAAAATGATGACCTCGTGCAGAGA
  CTAATGGACATCCTGTATGCTTCAGAAGAACACGAGGGCCACACAGAAGAGCCGGAAGCAGAGGAGCAAG
  CCCACGAACAGCAGCCCCCGCAGCAGGAAGAGTACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001143827
• ORF Size: 948 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001143827.2, NP_001137299.1
• RefSeq Size: 4337
• RefSeq ORF: 948
• Locus ID: 10982
• Protein Families: Druggable Genome
• Gene Summary: The protein encoded by this gene shares significant homology to the adenomatous polyposis coli (APC) protein-binding EB1 gene family. This protein is a microtubule-associated protein that is necessary for spindle symmetry during mitosis. It is thought to play a role in the tumorigenesis of colorectal cancers and the proliferative control of normal cells. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
  Transcript Variant: This variant (3) has alternate 5' exon structure and it thus differs in the 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.