Calumenin (CALU) (NM_001130674) Human Untagged Clone
CAT#: SC325760
CALU (untagged)-Human calumenin (CALU), transcript variant 2
"NM_001130674" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CALU |
Synonyms | FLJ90608 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001130674, the custom clone sequence may differ by one or more nucleotides
ATGGACCTGCGACAGTTTCTTATGTGCCTGTCCCTGTGCACAGCCTTTGCCTTGAGCAAACCCACAGAAA AGAAGGACCGTGTACATCATGAGCCTCAGCTCAGTGACAAGGTTCACAATGATGCTCAGAGTTTTGATTA TGACCATGATGCCTTCTTGGGTGCTGAAGAAGCAAAGACCTTTGATCAGCTGACACCAGAAGAGAGCAAG GAAAGGCTTGGAATGATTGTAGATAAAATAGACGCGGATAAAGATGGGTTTGTGACGGAGGGGGAGCTGA AATCCTGGATTAAGCACGCCCAGAAGAAATACATATATGACAATGTTGAAAACCAATGGCAGGAGTTTGA TATGAATCAAGACGGCTTAATCTCCTGGGATGAGTACAGAAACGTGACTTATGGCACTTACCTGGATGAT CCAGATCCTGATGATGGATTTAACTATAAACAGATGATGGTTAGAGATGAGCGGAGGTTTAAAATGGCAG ACAAGGATGGAGACCTCATTGCCACCAAGGAGGAGTTCACAGCTTTCCTGCACCCTGAGGAGTATGACTA CATGAAAGATATAGTAGTACAGGAAACAATGGAAGATATAGATAAGAATGCTGATGGTTTCATTGATCTA GAAGAGTATATTGGTGACATGTACAGCCATGATGGGAATACTGATGAGCCAGAATGGGTAAAGACAGAGC GAGAGCAGTTTGTTGAGTTTCGGGATAAGAACCGTGATGGGAAGATGGACAAGGAAGAGACCAAAGACTG GATCCTTCCCTCAGACTATGATCATGCAGAGGCAGAAGCCAGGCACCTGGTCTATGAATCAGACCAAAAC AAGGATGGCAAGCTTACCAAGGAGGAGATCGTTGACAAGTATGACTTATTTGTTGGCAGCCAGGCCACAG ATTTTGGGGAGGCCTTAGTACGGCATGATGAGTTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001130674 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001130674.2, NP_001124146.1 |
RefSeq Size | 5366 bp |
RefSeq ORF | 948 bp |
Locus ID | 813 |
Cytogenetics | 7q32.1 |
Protein Families | Secreted Protein |
Gene Summary | 'The product of this gene is a calcium-binding protein localized in the endoplasmic reticulum (ER) and it is involved in such ER functions as protein folding and sorting. This protein belongs to a family of multiple EF-hand proteins (CERC) that include reticulocalbin, ERC-55, and Cab45 and the product of this gene. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]' Transcript Variant: This variant (2) has an alternate in-frame exon, compared to variant 1. The resulting isoform (b) is of the same length but has a different internal segment, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225448 | CALU (Myc-DDK-tagged)-Human calumenin (CALU), transcript variant 2 |
USD 420.00 |
|
RG225448 | CALU (GFP-tagged) - Human calumenin (CALU), transcript variant 2 |
USD 460.00 |
|
RC225448L1 | Lenti ORF clone of Human calumenin (CALU), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC225448L2 | Lenti ORF clone of Human calumenin (CALU), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC225448L3 | Lenti ORF clone of Human calumenin (CALU), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC225448L4 | Lenti ORF clone of Human calumenin (CALU), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review