MKRN1 (NM_001145125) Human Untagged Clone
CAT#: SC325775
MKRN1 (untagged)-Human makorin ring finger protein 1 (MKRN1), transcript variant 2
"NM_001145125" in other vectors (4)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | MKRN1 |
| Synonyms | RNF61 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001145125, the custom clone sequence may differ by one or more nucleotides
ATGGCGGAGGCTGCAACTCCCGGAACAACAGCCACAACATCAGGAGCAGGAGCGGCAGCGGCGACGGCGG CAGCAGCCTCCCCCACCCCGATCCCCACAGTCACCGCCCCGTCCCTGGGGGCGGGCGGAGGGGGCGGCGG CAGCGACGGCAGCGGCGGCGGCTGGACTAAACAGGTCACCTGCAGGTATTTTATGCATGGGGTTTGTAAG GAAGGAGACAACTGTCGCTACTCGCATGACCTCTCTGACAGTCCGTATAGTGTAGTGTGCAAGTATTTTC AGCGAGGGTACTGTATTTATGGAGACCGCTGCAGATATGAACATAGCAAACCATTGAAACAGGAAGAAGC AACTGCTACAGAGCTAACTACAAAGTCATCCCTTGCTGCTTCCTCAAGTCTCTCATCGATAGTTGGACCA CTTGTTGAAATGAATACAGGCGAAGCTGAGTCAAGAAATTCAAACTTTGCAACTGTAGGAGCAGGTTCAG AGGACTGGGTGAATGCTATTGAGTTTGTTCCTGGGCAACCCTACTGTGGCCGTACTGCGCCTTCCTGCAC TGAAGCACCCCTGCAGGGCTCAGTGACCAAGGAAGAATCAGAGAAAGAGCAAACCGCCGTGGAGACAAAG AAGCAGCTGTGCCCCTATGCTGCAGTGGGAGAGTGCCGATACGGGGAGAACTGTGTGTATCTCCACGGAG ATTCTTGTGACATGTGTGGGCTGCAGGTCCTGCATCCAATGGATGCTGCCCAGAGATCGCAGCATATCAA ATCGTGCATTGAGGCCCATGAGAAGGACATGGAGCTCTCATTTGCCGTGCAGCGCAGCAAGGACATGGTG TGTGGGATCTGCATGGAGGTGGTCTATGAGAAAGCCAACCCCAGTGAGCGCCGCTTCGGGATCCTCTCCA ACTGCAACCACACCTACTGTCTCAAGTGCATTCGCAAGTGGAGGAGTGCTAAGCAATTTGAGAGCAAGAT CATAAAGTGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001145125 |
| ORF Size | 990 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Reference Data | |
| RefSeq | NM_001145125.1, NP_001138597.1 |
| RefSeq Size | 1686 |
| RefSeq ORF | 990 |
| Locus ID | 23608 |
| Protein Families | Druggable Genome |
| Gene Summary | This gene encodes a protein that belongs to a novel class of zinc finger proteins. The encoded protein functions as a transcriptional co-regulator, and as an E3 ubiquitin ligase that promotes the ubiquitination and proteasomal degradation of target proteins. The protein encoded by this gene is thought to regulate RNA polymerase II-catalyzed transcription. Substrates for this protein's E3 ubiquitin ligase activity include the capsid protein of the West Nile virus and the catalytic subunit of the telomerase ribonucleoprotein. This protein controls cell cycle arrest and apoptosis by regulating p21, a cell cycle regulator, and the tumor suppressor protein p53. Pseudogenes of this gene are present on chromosomes 1, 3, 9, 12 and 20, and on the X chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014] Transcript Variant: This variant (2) contains a 3' terminal exon that extends past a splice site that is used in variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC226557 | MKRN1 (Myc-DDK-tagged)-Human makorin ring finger protein 1 (MKRN1), transcript variant 2 |
USD 300.00 |
|
| RG226557 | MKRN1 (GFP-tagged) - Human makorin ring finger protein 1 (MKRN1), transcript variant 2 |
USD 460.00 |
|
| RC226557L3 | Lenti ORF clone of Human makorin ring finger protein 1 (MKRN1), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
| RC226557L4 | Lenti ORF clone of Human makorin ring finger protein 1 (MKRN1), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China