LDB2 (NM_001130834) Human Untagged Clone
CAT#: SC325781
LDB2 (untagged)-Human LIM domain binding 2 (LDB2), transcript variant 2
"NM_001130834" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | LDB2 |
Synonyms | CLIM1; LDB-2; LDB1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001130834, the custom clone sequence may differ by one or more nucleotides
ATGTCCAGCACACCACATGACCCCTTCTATTCTTCTCCTTTCGGCCCATTTTATAGGAGGCATACACCAT ACATGGTACAGCCAGAGTACCGAATCTATGAGATGAACAAGAGACTGCAGTCTCGCACAGAGGATAGTGA CAACCTCTGGTGGGACGCCTTTGCCACTGAATTTTTTGAAGATGACGCCACATTAACCCTTTCATTTTGT TTGGAAGATGGACCAAAGCGATACACTATCGGCAGGACCCTCATCCCCCGTTACTTTAGCACTGTGTTTG AAGGAGGGGTGACCGACCTGTATTACATTCTCAAACACTCGAAAGAGTCATACCACAACTCATCCATCAC GGTGGACTGCGACCAGTGTACCATGGTCACCCAGCACGGGAAGCCCATGTTTACCAAGGTATGTACAGAA GGCAGACTGATCTTGGAGTTCACCTTTGATGATCTCATGAGAATCAAAACATGGCACTTTACCATTAGAC AATACCGAGAGTTAGTCCCGAGAAGCATCCTAGCCATGCATGCACAAGATCCTCAGGTCCTGGATCAGCT GTCCAAAAACATCACCAGGATGGGGCTAACAAACTTCACCCTCAACTACCTCAGGTTGTGTGTAATATTG GAGCCAATGCAGGAACTGATGTCGAGACATAAAACTTACAACCTCAGTCCCCGAGACTGCCTGAAGACCT GCTTGTTTCAGAAGTGGCAGAGGATGGTGGCTCCGCCAGCAGAACCCACAAGGCAACCAACAACCAAACG GAGAAAAAGGAAAAATTCCACCAGCAGCACTTCCAACAGCAGCGCTGGGAACAATGCAAACAGCACTGGC AGCAAGAAGAAGACCACAGCTGCAAACCTGAGTCTGTCCAGTCAGGTACCTGGGCTAGGAGCGATCCCGA ACTGCAGCCTCAACCCTGGGAGGGATGGAGACCTGTGTCATTCAACAGCAGTGACCCCTTCTGGCCAATT TAAGGAGAAGCATTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001130834 |
ORF Size | 996 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001130834.2, NP_001124306.1 |
RefSeq Size | 2698 |
RefSeq ORF | 996 |
Locus ID | 9079 |
Gene Summary | The protein encoded by this gene belongs to the LIM-domain binding family. Members of this family are characterized by a conserved nuclear localization sequence, an amino-terminal homodimerization domain and a carboxy-terminal LIM interaction domain. These proteins function as adapter molecules to allow assembly of transcriptional regulatory complexes. Genetic association studies suggest functions for this gene in rhegmatogenous retinal detachment and coronary artery disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015] Transcript Variant: This variant (2) contains an alternate exon in the 3' coding region and differs in the 3' UTR compared to variant 1. It encodes isoform b, which is shorter and has a distinct C-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225484 | LDB2 (Myc-DDK-tagged)-Human LIM domain binding 2 (LDB2), transcript variant 2 |
USD 420.00 |
|
RG225484 | LDB2 (GFP-tagged) - Human LIM domain binding 2 (LDB2), transcript variant 2 |
USD 460.00 |
|
RC225484L3 | Lenti ORF clone of Human LIM domain binding 2 (LDB2), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC225484L4 | Lenti ORF clone of Human LIM domain binding 2 (LDB2), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review