LDB2 (NM_001130834) Human Untagged Clone

CAT#: SC325781

LDB2 (untagged)-Human LIM domain binding 2 (LDB2), transcript variant 2


  "NM_001130834" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "LDB2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LDB2
Synonyms CLIM1; LDB-2; LDB1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001130834, the custom clone sequence may differ by one or more nucleotides


ATGTCCAGCACACCACATGACCCCTTCTATTCTTCTCCTTTCGGCCCATTTTATAGGAGGCATACACCAT
ACATGGTACAGCCAGAGTACCGAATCTATGAGATGAACAAGAGACTGCAGTCTCGCACAGAGGATAGTGA
CAACCTCTGGTGGGACGCCTTTGCCACTGAATTTTTTGAAGATGACGCCACATTAACCCTTTCATTTTGT
TTGGAAGATGGACCAAAGCGATACACTATCGGCAGGACCCTCATCCCCCGTTACTTTAGCACTGTGTTTG
AAGGAGGGGTGACCGACCTGTATTACATTCTCAAACACTCGAAAGAGTCATACCACAACTCATCCATCAC
GGTGGACTGCGACCAGTGTACCATGGTCACCCAGCACGGGAAGCCCATGTTTACCAAGGTATGTACAGAA
GGCAGACTGATCTTGGAGTTCACCTTTGATGATCTCATGAGAATCAAAACATGGCACTTTACCATTAGAC
AATACCGAGAGTTAGTCCCGAGAAGCATCCTAGCCATGCATGCACAAGATCCTCAGGTCCTGGATCAGCT
GTCCAAAAACATCACCAGGATGGGGCTAACAAACTTCACCCTCAACTACCTCAGGTTGTGTGTAATATTG
GAGCCAATGCAGGAACTGATGTCGAGACATAAAACTTACAACCTCAGTCCCCGAGACTGCCTGAAGACCT
GCTTGTTTCAGAAGTGGCAGAGGATGGTGGCTCCGCCAGCAGAACCCACAAGGCAACCAACAACCAAACG
GAGAAAAAGGAAAAATTCCACCAGCAGCACTTCCAACAGCAGCGCTGGGAACAATGCAAACAGCACTGGC
AGCAAGAAGAAGACCACAGCTGCAAACCTGAGTCTGTCCAGTCAGGTACCTGGGCTAGGAGCGATCCCGA
ACTGCAGCCTCAACCCTGGGAGGGATGGAGACCTGTGTCATTCAACAGCAGTGACCCCTTCTGGCCAATT
TAAGGAGAAGCATTGA


Restriction Sites SgfI-MluI     
ACCN NM_001130834
ORF Size 996 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001130834.2, NP_001124306.1
RefSeq Size 2698
RefSeq ORF 996
Locus ID 9079
Gene Summary The protein encoded by this gene belongs to the LIM-domain binding family. Members of this family are characterized by a conserved nuclear localization sequence, an amino-terminal homodimerization domain and a carboxy-terminal LIM interaction domain. These proteins function as adapter molecules to allow assembly of transcriptional regulatory complexes. Genetic association studies suggest functions for this gene in rhegmatogenous retinal detachment and coronary artery disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Transcript Variant: This variant (2) contains an alternate exon in the 3' coding region and differs in the 3' UTR compared to variant 1. It encodes isoform b, which is shorter and has a distinct C-terminus compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.