TRIM17 (NM_001134855) Human Untagged Clone
CAT#: SC325795
TRIM17 (untagged)-Human tripartite motif containing 17 (TRIM17), transcript variant 4
"NM_001134855" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TRIM17 |
Synonyms | RBCC; RNF16; terf |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001134855, the custom clone sequence may differ by one or more nucleotides
ATGGAGGCTGTGGAACTCGCCAGAAAACTGCAGGAGGAAGCTACGTGCTCCATCTGTCTGGATTACTTCA CAGACCCTGTGATGACCACCTGTGGCCACAACTTCTGCCGAGCCTGCATCCAGCTGAGCTGGGAAAAGGC GAGGGGCAAGAAGGGGAGGCGGAAGCGGAAGGGCTCCTTCCCCTGCCCCGAGTGCAGAGAGATGTCCCCG CAGAGGAACCTGCTGCCCAACCGGCTGCTGACCAAGGTGGCCGAGATGGCGCAGCAGCATCCTGGTCTGC AGAAGCAAGACCTGTGCCAGGAGCACCACGAGCCCCTCAAGCTTTTCTGCCAGAAGGACCAGAGCCCCAT CTGTGTGGTGTGCAGGGAGTCCCGGGAGCACCGGCTGCACAGGGTGCTGCCCGCCGAGGAGGCAGTGCAG GGGTACAAGTTGAAGCTGGAGGAGGACATGGAGTACCTTCGGGAGCAGATCACCAGGACAGGGAATCTGC AGGCCAGGGAGGAGCAGAGCTTAGCCGAGTGGCAGGGCAAGGTGAAGGAGCGGAGAGAACGCATTGTGCT GGAGTTTGAGAAGATGAACCTCTACCTGGTGGAAGAAGAGCAGAGGCTCCTCCAGGCTCTGGAGACGGAA GAAGAGGAGACTGCCAGCAGGCTCCGGGAGAGCGTGGCCTGCCTGGACCGGCAGGGTCACTCTCTGGAGC TGCTGCTGCTGCAGCTGGAGGAGCGGAGCACACAGGGGCCCCTCCAGATGCTGCAGGACATGAAGGAACC CCTGAGCAGGAAGAACAACGTGAGTGTGCAGTGCCCAGAGGTTGCCCCCCCAACCAGACCCAGGACTGTG TGCAGAGTTCCCGGACAGATTGAAGTGCTAAGAGGCTTTCTAGGTAAGTGGGCACCCAGGGCCAGGACCT CTGACCCAGGATCTCTTGGCGATGCCCCACTGTACCCCCTAGCCTCGGAAGCCACCAATGGGGGGGGTTC TACAAGTGCACTGCCTGGTGACGGTCACTGGCTATTCACTGTGCCTTCGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001134855 |
ORF Size | 1032 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001134855.1, NP_001128327.1 |
RefSeq Size | 1782 |
RefSeq ORF | 1032 |
Locus ID | 51127 |
Protein Families | Druggable Genome |
Gene Summary | The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. The protein is expressed almost exclusively in the testis, but its function is unknown. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4) differs in the 5' UTR and 3' coding region and UTR, compared to variant 1. The encoded protein (isoform 3) has a shorter and distinct C-terminus that lacks a SPRY domain, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225509 | TRIM17 (Myc-DDK-tagged)-Human tripartite motif containing 17 (TRIM17), transcript variant 4 |
USD 420.00 |
|
RG225509 | TRIM17 (GFP-tagged) - Human tripartite motif containing 17 (TRIM17), transcript variant 4 |
USD 460.00 |
|
RC225509L3 | Lenti ORF clone of Human tripartite motif containing 17 (TRIM17), transcript variant 4, Myc-DDK-tagged |
USD 620.00 |
|
RC225509L4 | Lenti ORF clone of Human tripartite motif containing 17 (TRIM17), transcript variant 4, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review