BTN3A1 (NM_194441) Human Untagged Clone

CAT#: SC325808

BTN3A1 (untagged)-Human butyrophilin, subfamily 3, member A1 (BTN3A1), transcript variant 2


  "NM_194441" in other vectors (4)

Reconstitution Protocol

USD 600.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "BTN3A1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BTN3A1
Synonyms BT3.1; BTF5; BTN3.1; CD277
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_194441, the custom clone sequence may differ by one or more nucleotides


ATGAAAATGGCAAGTTTCCTGGCCTTCCTTCTGCTCAACTTTCGTGTCTGCCTCCTTTTGCTTCAGCTGC
TCATGCCTCACTCAGCTCAGTTTTCTGTGCTTGGACCCTCTGGGCCCATCCTGGCCATGGTGGGTGAAGA
CGCTGATCTGCCCTGTCACCTGTTCCCGACCATGAGTGCAGAGACCATGGAGCTGAAGTGGGTGAGTTCC
AGCCTAAGGCAGGTGGTGAACGTGTATGCAGATGGAAAGGAAGTGGAAGACAGGCAGAGTGCACCGTATC
GAGGGAGAACTTCGATTCTGCGGGATGGCATCACTGCAGGGAAGGCTGCTCTCCGAATACACAACGTCAC
AGCCTCTGACAGTGGAAAGTACTTGTGTTATTTCCAAGATGGTGACTTCTATGAAAAAGCCCTGGTGGAG
CTGAAGGTTGCAGCACTGGGTTCTGATCTTCACGTTGATGTGAAGGGTTACAAGGATGGAGGGATCCATC
TGGAGTGCAGGTCCACTGGCTGGTACCCCCAACCCCAAATACAGTGGAGCAACAACAAGGGAGAGAACAT
CCCGACTGTGGAAGCACCTGTGGTTGCAGACGGAGTGGGCCTGTATGCAGTAGCAGCATCTGTGATCATG
AGAGGCAGCTCTGGGGAGGGTGTATCCTGTACCATCAGAAGTTCCCTCCTCGGCCTGGAAAAGACAGCCA
GCATTTCCATCGCAGACCCCTTCTTCAGGAGCGCCCAGAGGTGGATCGCCGCCCTGGCAGGGACCCTGCC
TGTCTTGCTGCTGCTTCTTGGGGGAGCCGGTTACTTCCTGTGGCAACAGCAGGAGGAAAAAAAGACTCAG
TTCAGAAAGAAAAAGAGAGAGCAAGAGTTGAGAGAAATGGCATGGAGCACAATGAAGCAAGAACAAAGCA
CAAGAGTGAAGCTCCTGGAGGAACTCAGATGGAGAAGTATCCAGTATGCATCTCGGGGAGAGAGACATTC
AGCCTATAATGAATGGAAAAAGGCCCTCTTCAAGCCTGGTGAGGAAATGCTTCAGATGAGGCTCCACTTT
GTTAAATAA


Restriction Sites SgfI-MluI     
ACCN NM_194441
ORF Size 1059 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_194441.2, NP_919423.1
RefSeq Size 3728
RefSeq ORF 1059
Locus ID 11119
Protein Families Druggable Genome, Transmembrane
Gene Summary The butyrophilin (BTN) genes are a group of major histocompatibility complex (MHC)-associated genes that encode type I membrane proteins with 2 extracellular immunoglobulin (Ig) domains and an intracellular B30.2 (PRYSPRY) domain. Three subfamilies of human BTN genes are located in the MHC class I region: the single-copy BTN1A1 gene (MIM 601610) and the BTN2 (e.g., BTN2A1; MIM 613590) and BTN3 (e.g., BNT3A1) genes, which have undergone tandem duplication, resulting in 3 copies of each (summary by Smith et al., 2010 [PubMed 20208008]). [supplied by OMIM, Nov 2010]
Transcript Variant: This variant (2) differs in the 5' and 3' UTRs, and uses an alternate splice site in the 3' coding region, compared to variant 1. The resulting isoform (b) has a distinct C-terminus and is shorter than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.