GUCY1A3 (NM_001130686) Human Untagged Clone
CAT#: SC325830
GUCY1A3 (untagged)-Human guanylate cyclase 1, soluble, alpha 3 (GUCY1A3), transcript variant 6
"NM_001130686" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GUCY1A3 |
Synonyms | GC-SA3; GUC1A3; GUCA3; GUCSA3; GUCY1A1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001130686, the custom clone sequence may differ by one or more nucleotides
ATGTTCTGCACGAAGCTCAAGGATCTCAAGATCACAGGAGAGTGTCCTTTCTCCTTACTGGCACCAGGTC AAGTTCCTAACGAGTCTTCAGAGGAGGCAGCAGGAAGCTCAGAGAGCTGCAAAGCAACCGTGCCCATCTG TCAAGACATTCCTGAGAAGAACATACAAGAAAGTCTTCCTCAAAGAAAAACCAGTCGGAGCCGAGTCTAT CTTCACACTTTGGCAGAGAGTATTTGCAAACTGATTTTCCCAGAGTTTGAACGGCTGAATGTTGCACTTC AGAGAACATTGGCAAAGCACAAAATAAAAGAAAGCAGGAAATCTTTGGAAAGAGAAGACTTTGAAAAAAC AATTGCAGAGCAAGCAGTTGCAGCAGGAGTTCCAGTGGAGGTTATCAAAGAATCTCTTGGTGAAGAGGTT TTTAAAATATGTTACGAGGAAGATGAAAACATCCTTGGGGTGGTTGGAGGCACCCTTAAAGATTTTTTAA ACAGCTTCAGTACCCTTCTGAAACAGAGCAGCCATTGCCAAGAAGCAGGAAAAAGGGGCAGGCTTGAGGA CGCCTCCATTCTATGCCTGGATAAGGAGGATGATTTTCTACATGTTTACTACTTCTTCCCTAAGAGAACC ACCTCCCTGATTCTTCCCGGCATCATAAAGGCAGCTGCTCACGTATTATATGAAACGGAAGTGGAAGTGT CGTTAATGCCTCCCTGCTTCCATAATGATTGCAGCGAGTTTGTGAATCAGCCCTACTTGTTGTACTCCGT TCACATGAAAAGCACCAAGCCATCCCTGTCCCCCAGCAAACCCCAGTCCTCGCTGGTGATTCCCACATCG CTATTCTGCAAGACATTTCCATTCCATTTCATGTTTGACAAAGATATGACAATTCTGCAATTTGGCAATG GCATCAGAAGGCTGATGAACAGGAGAGACTTTCAAGGAAAGCCTAATTTTGAAGAATACTTTGAAATTCT GACTCCAAAAATCAACCAGACGTTTAGCGGGATCATGACTATGTTGAATATGCAGTTTGTTGTACGAGTG AGGAGATGGGACAACTCTGTGAAAAAATCTTCAAGGGTAAGGAAAACATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001130686 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001130686.1, NP_001124158.1 |
RefSeq Size | 1658 bp |
RefSeq ORF | 1101 bp |
Locus ID | 2982 |
Cytogenetics | 4q32.1 |
Protein Families | Druggable Genome |
Protein Pathways | Gap junction, Long-term depression, Purine metabolism, Vascular smooth muscle contraction |
Gene Summary | 'Soluble guanylate cyclases are heterodimeric proteins that catalyze the conversion of GTP to 3',5'-cyclic GMP and pyrophosphate. The protein encoded by this gene is an alpha subunit of this complex and it interacts with a beta subunit to form the guanylate cyclase enzyme, which is activated by nitric oxide. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]' Transcript Variant: This variant (6) differs in the 5' UTR and uses an alternate splice site in the 3' coding region that results in a premature translation termination site, compared to variant 1. The encoded protein (isoform C) has a shorter and distinct C-terminus, compared to isoform A. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225555 | GUCY1A3 (Myc-DDK-tagged)-Human guanylate cyclase 1, soluble, alpha 3 (GUCY1A3), transcript variant 6 |
USD 420.00 |
|
RG225555 | GUCY1A3 (GFP-tagged) - Human guanylate cyclase 1, soluble, alpha 3 (GUCY1A3), transcript variant 6 |
USD 460.00 |
|
RC225555L3 | Lenti-ORF clone of GUCY1A3 (Myc-DDK-tagged)-Human guanylate cyclase 1, soluble, alpha 3 (GUCY1A3), transcript variant 6 |
USD 620.00 |
|
RC225555L4 | Lenti-ORF clone of GUCY1A3 (mGFP-tagged)-Human guanylate cyclase 1, soluble, alpha 3 (GUCY1A3), transcript variant 6 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review