GUCY1A3 (NM_001130686) Human Untagged Clone

CAT#: SC325830

GUCY1A3 (untagged)-Human guanylate cyclase 1, soluble, alpha 3 (GUCY1A3), transcript variant 6


  "NM_001130686" in other vectors (4)

Reconstitution Protocol

USD 630.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GUCY1A3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GUCY1A3
Synonyms GC-SA3; GUC1A3; GUCA3; GUCSA3; GUCY1A1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001130686, the custom clone sequence may differ by one or more nucleotides


ATGTTCTGCACGAAGCTCAAGGATCTCAAGATCACAGGAGAGTGTCCTTTCTCCTTACTGGCACCAGGTC
AAGTTCCTAACGAGTCTTCAGAGGAGGCAGCAGGAAGCTCAGAGAGCTGCAAAGCAACCGTGCCCATCTG
TCAAGACATTCCTGAGAAGAACATACAAGAAAGTCTTCCTCAAAGAAAAACCAGTCGGAGCCGAGTCTAT
CTTCACACTTTGGCAGAGAGTATTTGCAAACTGATTTTCCCAGAGTTTGAACGGCTGAATGTTGCACTTC
AGAGAACATTGGCAAAGCACAAAATAAAAGAAAGCAGGAAATCTTTGGAAAGAGAAGACTTTGAAAAAAC
AATTGCAGAGCAAGCAGTTGCAGCAGGAGTTCCAGTGGAGGTTATCAAAGAATCTCTTGGTGAAGAGGTT
TTTAAAATATGTTACGAGGAAGATGAAAACATCCTTGGGGTGGTTGGAGGCACCCTTAAAGATTTTTTAA
ACAGCTTCAGTACCCTTCTGAAACAGAGCAGCCATTGCCAAGAAGCAGGAAAAAGGGGCAGGCTTGAGGA
CGCCTCCATTCTATGCCTGGATAAGGAGGATGATTTTCTACATGTTTACTACTTCTTCCCTAAGAGAACC
ACCTCCCTGATTCTTCCCGGCATCATAAAGGCAGCTGCTCACGTATTATATGAAACGGAAGTGGAAGTGT
CGTTAATGCCTCCCTGCTTCCATAATGATTGCAGCGAGTTTGTGAATCAGCCCTACTTGTTGTACTCCGT
TCACATGAAAAGCACCAAGCCATCCCTGTCCCCCAGCAAACCCCAGTCCTCGCTGGTGATTCCCACATCG
CTATTCTGCAAGACATTTCCATTCCATTTCATGTTTGACAAAGATATGACAATTCTGCAATTTGGCAATG
GCATCAGAAGGCTGATGAACAGGAGAGACTTTCAAGGAAAGCCTAATTTTGAAGAATACTTTGAAATTCT
GACTCCAAAAATCAACCAGACGTTTAGCGGGATCATGACTATGTTGAATATGCAGTTTGTTGTACGAGTG
AGGAGATGGGACAACTCTGTGAAAAAATCTTCAAGGGTAAGGAAAACATAA


Restriction Sites SgfI-MluI     
ACCN NM_001130686
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001130686.1, NP_001124158.1
RefSeq Size 1658 bp
RefSeq ORF 1101 bp
Locus ID 2982
Cytogenetics 4q32.1
Protein Families Druggable Genome
Protein Pathways Gap junction, Long-term depression, Purine metabolism, Vascular smooth muscle contraction
Gene Summary 'Soluble guanylate cyclases are heterodimeric proteins that catalyze the conversion of GTP to 3',5'-cyclic GMP and pyrophosphate. The protein encoded by this gene is an alpha subunit of this complex and it interacts with a beta subunit to form the guanylate cyclase enzyme, which is activated by nitric oxide. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]'
Transcript Variant: This variant (6) differs in the 5' UTR and uses an alternate splice site in the 3' coding region that results in a premature translation termination site, compared to variant 1. The encoded protein (isoform C) has a shorter and distinct C-terminus, compared to isoform A.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.