LEF1 (NM_001130713) Human Untagged Clone
CAT#: SC325836
LEF1 (untagged)-Human lymphoid enhancer-binding factor 1 (LEF1), transcript variant 2
"NM_001130713" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | LEF1 |
Synonyms | LEF-1; TCF1ALPHA; TCF7L3; TCF10 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001130713, the custom clone sequence may differ by one or more nucleotides
ATGCCCCAACTCTCCGGAGGAGGTGGCGGCGGCGGGGGGGACCCGGAACTCTGCGCCACGGACGAGATGA TCCCCTTCAAGGACGAGGGCGATCCTCAGAAGGAAAAGATCTTCGCCGAGATCAGTCATCCCGAAGAGGA AGGCGATTTAGCTGACATCAAGTCTTCCTTGGTGAACGAGTCTGAAATCATCCCGGCCAGCAACGGACAC GAGGTGGCCAGACAAGCACAAACCTCTCAGGAGCCCTACCACGACAAGGCCAGAGAACACCCCGATGACG GAAAGCATCCAGATGGAGGCCTCTACAACAAGGGACCCTCCTACTCGAGTTATTCCGGGTACATAATGAT GCCAAATATGAATAACGACCCATACATGTCAAATGGATCTCTTTCTCCACCCATCCCGAGAACATCAAAT AAAGTGCCCGTGGTGCAGCCATCCCATGCGGTCCATCCTCTCACCCCCCTCATCACTTACAGTGACGAGC ACTTTTCTCCAGGATCACACCCGTCACACATCCCATCAGATGTCAACTCCAAACAAGGCATGTCCAGACA TCCTCCAGCTCCTGATATCCCTACTTTTTATCCCTTGTCTCCGGGTGGTGTTGGACAGATCACCCCACCT CTTGGCTGGTTTTCCCATCATATGATTCCCGGTCCTCCTGGTCCCCACACAACTGGCATCCCTCATCCAG CTATTGTAACACCTCAGGTCAAACAGGAACATCCCCACACTGACAGTGACCTAATGCACGTGAAGCCTCA GCATGAACAGAGAAAGGAGCAGGAGCCAAAAAGACCTCACATTAAGAAGCCTCTGAATGCTTTTATGTTA TACATGAAAGAAATGAGAGCGAATGTCGTTGCTGAGTGTACTCTAAAAGAAAGTGCAGCTATCAACCAGA TTCTTGGCAGAAGGTGGCATGCCCTCTCCCGTGAAGAGCAGGCTAAATATTATGAATTAGCACGGAAAGA AAGACAGCTACATATGCAGCTTTATCCAGGCTGGTCTGCAAGAGACAATTATGGTAAGAAAAAGAAGAGG AAGAGAGAGAAACTACAGGAATCTGCATCAGGTACAGGTCCAAGAATGACAGCTGCCTACATCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001130713 |
ORF Size | 1116 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001130713.2, NP_001124185.1 |
RefSeq Size | 3536 |
RefSeq ORF | 1116 |
Locus ID | 51176 |
Protein Families | Adult stem cells, Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors |
Protein Pathways | Acute myeloid leukemia, Adherens junction, Arrhythmogenic right ventricular cardiomyopathy (ARVC), Basal cell carcinoma, Colorectal cancer, Endometrial cancer, Melanogenesis, Pathways in cancer, Prostate cancer, Thyroid cancer, Wnt signaling pathway |
Gene Summary | This gene encodes a transcription factor belonging to a family of proteins that share homology with the high mobility group protein-1. The protein encoded by this gene can bind to a functionally important site in the T-cell receptor-alpha enhancer, thereby conferring maximal enhancer activity. This transcription factor is involved in the Wnt signaling pathway, and it may function in hair cell differentiation and follicle morphogenesis. Mutations in this gene have been found in somatic sebaceous tumors. This gene has also been linked to other cancers, including androgen-independent prostate cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (2) that is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225565 | LEF1 (Myc-DDK-tagged)-Human lymphoid enhancer-binding factor 1 (LEF1), transcript variant 2 |
USD 98.00 |
|
RG225565 | LEF1 (GFP-tagged) - Human lymphoid enhancer-binding factor 1 (LEF1), transcript variant 2 |
USD 460.00 |
|
RC225565L3 | Lenti ORF clone of Human lymphoid enhancer-binding factor 1 (LEF1), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC225565L4 | Lenti ORF clone of Human lymphoid enhancer-binding factor 1 (LEF1), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review