Caspase 5 (CASP5) (NM_001136109) Human Untagged Clone
CAT#: SC325844
CASP5 (untagged)-Human caspase 5, apoptosis-related cysteine peptidase (CASP5), transcript variant b
"NM_001136109" in other vectors (4)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | CASP5 |
| Synonyms | ICE(rel)III; ICEREL-III; ICH-3 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001136109, the custom clone sequence may differ by one or more nucleotides
ATGGCTGAAGACAACCACAAAAAAAAAACAGTTAAGATGTTGGAATACCTGGGCAAAGATGTTCTTCATG GTGTTTTTAATTATTTGGCAAAACACGATGTTCTGACATTGAAGGAAGAGGAAAAGAAAAAATATTATGA TACCAAAATTGAAGACAAGGCCCTGATCTTGGTAGACTCTTTGCGAAAGAATCGCGTGGCTCATCAAATG TTTACCCAAACACTTCTCAATATGGACCAAAAGATCACCAGTGTAAAACCTCTTCTGCAAATCGAGGCTG GACCACCTGAGTCAGCAGAATCTACAAATATACTCAAACTTTGTCCTCGTGAAGAATTCCTGAGACTGTG TAAAAAAAATCATGATGAGATCTATCCAATAAAAAAGAGAGAGGACCGCAGACGCCTGGCTCTCATCATA TGCAATACAAAGTTTGATCACCTGCCTGCAAGGAATGGGGCTCACTATGACATCGTGGGGATGAAAAGGC TGCTTCAAGGCCTGGGCTACACTGTGGTTGACGAAAAGAATCTCACAGCCAGGGATATGGAGTCAGTGCT GAGGGCATTTGCTGCCAGACCAGAGCACAAGTCCTCTGACAGCACGTTCTTGGTACTCATGTCTCATGGC ATCCTAGAGGGAATCTGCGGAACTGCGCATAAAAAGAAAAAACCGGATGTGCTGCTTTATGACACCATCT TCCAGATATTCAACAACCGCAACTGCCTCAGTCTAAAGGACAAACCCAAGGTCATCATTGTCCAGGCCTG CAGAGGTGAAAAACATGGGGAACTCTGGGTCAGAGACTCTCCAGCATCCTTGGCACTCATCTCTTCACAG TCATCTGAGAACCTGGAGGCAGATTCTGTTTGCAAGATCCACGAGGAGAAGGACTTCATTGCTTTCTGTT CTTCAACACCACATAACGTGTCCTGGAGAGACCGCACAAGGGGCTCCATCTTCATTACGGAACTCATCAC ATGCTTCCAGAAATATTCTTGCTGCTGCCACCTAATGGAAATATTTCGGAAGGTACAGAAATCATTTGAA GTTCCACAGGCTAAAGCCCAGATGCCCACCATAGAACGAGCAACCTTGACAAGAGATTTCTACCTCTTTC CTGGCAATTGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001136109 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001136109.1, NP_001129581.1 |
| RefSeq Size | 1275 bp |
| RefSeq ORF | 1131 bp |
| Locus ID | 838 |
| Cytogenetics | 11q22.3 |
| Protein Families | Druggable Genome, Protease |
| Protein Pathways | NOD-like receptor signaling pathway |
| Gene Summary | 'This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. Overexpression of the active form of this enzyme induces apoptosis in fibroblasts. Max, a central component of the Myc/Max/Mad transcription regulation network important for cell growth, differentiation, and apoptosis, is cleaved by this protein; this process requires Fas-mediated dephosphorylation of Max. The expression of this gene is regulated by interferon-gamma and lipopolysaccharide. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Aug 2010]' Transcript Variant: This variant (b) is lacking an in-frame coding exon compared to transcript variant a, resulting in a shorter isoform (b) missing a 58 aa protein segment compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227593 | CASP5 (Myc-DDK-tagged)-Human caspase 5, apoptosis-related cysteine peptidase (CASP5), transcript variant b |
USD 457.00 |
|
| RG227593 | CASP5 (GFP-tagged) - Human caspase 5, apoptosis-related cysteine peptidase (CASP5), transcript variant b |
USD 460.00 |
|
| RC227593L3 | Lenti-ORF clone of CASP5 (Myc-DDK-tagged)-Human caspase 5, apoptosis-related cysteine peptidase (CASP5), transcript variant b |
USD 620.00 |
|
| RC227593L4 | Lenti-ORF clone of CASP5 (mGFP-tagged)-Human caspase 5, apoptosis-related cysteine peptidase (CASP5), transcript variant b |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China