DC SIGN (CD209) (NM_001144896) Human Untagged Clone

CAT#: SC325851

CD209 (untagged)-Human CD209 molecule (CD209), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CD209
• Synonyms: CDSIGN; CLEC4L; DC-SIGN; DC-SIGN1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001144896, the custom clone sequence may differ by one or more nucleotides
  ATGAGTGACTCCAAGGAACCAAGACTGCAGCAGCTGGGCCTCCTGGAGGAGGAACAGCTG
  AGAGGCCTTGGATTCCGACAGACTCGAGGATACAAGAGCTTAGCAGTGTCCAAGGTCCCC
  AGCTCCATAAGTCAGGAACAATCCAGGCAAGACGCGATCTACCAGAACCTGACCCAGCTT
  AAAGCTGCAGTGGGTGAGCTCTCAGAGAAATCCAAGCTGCAGGAGATCTACCAGGAGCTG
  ACCCAGCTGAAGGCTGCAGTGGGTGAGCTTCCAGAGAAATCTAAGCTGCAGGAGATCTAC
  CAGGAGCTGACCCGGCTGAAGGCTGCAGTGGGTGAGCTTCCAGAGAAATCTAAGCTGCAG
  GAGATCTACCAGGAGCTGACCTGGCTGAAGGCTGCAGTGGGTGAGCTTCCAGAGAAATCT
  AAGATGCAGGAGATCTACCAGGAGCTGACTCGGCTGAAGGCTGCAGTGGGTGAGCTTCCA
  GAGAAATCTAAGCAGCAGGAGATCTACCAGGAGCTGACCCGGCTGAAGGCTGCAGTGGGT
  GAGCTTCCAGAGAAATCTAAGCAGCAGGAGATCTACCAGGAGCTGACCCGGCTGAAGGCT
  GCAGTGGGTGAGCTTCCAGAGAAATCTAAGCAGCAGGAGATCTACCAGGAGCTGACCCAG
  CTGAAGGCTGCAGTGGAACGCCTGTGCCACCCCTGTCCCTGGGAATGGACATTCTTCCAA
  GGAAACTGTTACTTCATGTCTAACTCCCAGCGGAACTGGCACGACTCCATCACCGCCTGC
  AAAGAAGTGGGGGCCCAGCTCGTCGTAATCAAAAGTGCTGAGGAGCAGAACTTCCTACAG
  CTGCAGTCTTCCAGAAGTAACCGCTTCACCTGGATGGGACTTTCAGATCTAAATCAGGAA
  GGCACGTGGCAATGGGTGGACGGCTCACCTCTGTTGCCCAGCTTCAAGCAGTATTGGAAC
  AGAGGAGAGCCCAACAACGTTGGGGAGGAAGACTGCGCGGAATTTAGTGGCAATGGCTGG
  AACGACGACAAATGTAATCTTGCCAAATTCTGGATCTGCAAAAAGTCCGCAGCCTCCTGC
  TCCAGGGATGAAGAACAGTTTCTTTCTCCAGCCCCTGCCACCCCAAACCCCCCTCCTGCG
  
• Restriction Sites: Please inquire
• ACCN: NM_001144896
• ORF Size: 1143 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001144896.1, NP_001138368.1
• RefSeq Size: 4256
• RefSeq ORF: 1143
• Locus ID: 30835
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a transmembrane receptor and is often referred to as DC-SIGN because of its expression on the surface of dendritic cells and macrophages. The encoded protein is involved in the innate immune system and recognizes numerous evolutionarily divergent pathogens ranging from parasites to viruses with a large impact on public health. The protein is organized into three distinct domains: an N-terminal transmembrane domain, a tandem-repeat neck domain and C-type lectin carbohydrate recognition domain. The extracellular region consisting of the C-type lectin and neck domains has a dual function as a pathogen recognition receptor and a cell adhesion receptor by binding carbohydrate ligands on the surface of microbes and endogenous cells. The neck region is important for homo-oligomerization which allows the receptor to bind multivalent ligands with high avidity. Variations in the number of 23 amino acid repeats in the neck domain of this protein are rare but have a significant impact on ligand binding ability. This gene is closely related in terms of both sequence and function to a neighboring gene (GeneID 10332; often referred to as L-SIGN). DC-SIGN and L-SIGN differ in their ligand-binding properties and distribution. Alternative splicing results in multiple variants. [provided by RefSeq, Feb 2009]
  Transcript Variant: This variant (3) lacks an alternate in-frame exon in the coding region, compared to variant 1. The encoded isoform (3) is shorter and lacks the transmembrane domain compared to isoform 1. Sequence Note: This record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.