Apolipoprotein L 1 (APOL1) (NM_001136541) Human Untagged Clone

CAT#: SC325852

APOL1 (untagged)-Human apolipoprotein L, 1 (APOL1), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: APOL1
• Synonyms: APO-L; APOL; APOL-I; FSGS4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001136541, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGGGAGCTGCTTTGCTGAGAGTCTCTGTCCTCTGCATCTGGGTGCAACAAAACGTTCCAAGTGGGA
  CAGATACTGGAGATCCTCAAAGTAAGCCCCTCGGTGACTGGGCTGCTGGCACCATGGACCCAGAGAGCAG
  TATCTTTATTGAGGATGCCATTAAGTATTTCAAGGAAAAAGTGAGCACACAGAATCTGCTACTCCTGCTG
  ACTGATAATGAGGCCTGGAACGGATTCGTGGCTGCTGCTGAACTGCCCAGGAATGAGGCAGATGAGCTCC
  GTAAAGCTCTGGACAACCTTGCAAGACAAATGATCATGAAAGACAAAAACTGGCACGATAAAGGCCAGCA
  GTACAGAAACTGGTTTCTGAAAGAGTTTCCTCGGTTGAAAAGTGAGCTTGAGGATAACATAAGAAGGCTC
  CGTGCCCTTGCAGATGGGGTTCAGAAGGTCCACAAAGGCACCACCATCGCCAATGTGGTGTCTGGCTCTC
  TCAGCATTTCCTCTGGCATCCTGACCCTCGTCGGCATGGGTCTGGCACCCTTCACAGAGGGAGGCAGCCT
  TGTACTCTTGGAACCTGGGATGGAGTTGGGAATCACAGCCGCTTTGACCGGGATTACCAGCAGTACCATG
  GACTACGGAAAGAAGTGGTGGACACAAGCCCAAGCCCACGACCTGGTCATCAAAAGCCTTGACAAATTGA
  AGGAGGTGAGGGAGTTTTTGGGTGAGAACATATCCAACTTTCTTTCCTTAGCTGGCAATACTTACCAACT
  CACACGAGGCATTGGGAAGGACATCCGTGCCCTCAGACGAGCCAGAGCCAATCTTCAGTCAGTACCGCAT
  GCCTCAGCCTCACGCCCCCGGGTCACTGAGCCAATCTCAGCTGAAAGCGGTGAACAGGTGGAGAGGGTTA
  ATGAACCCAGCATCCTGGAAATGAGCAGAGGAGTCAAGCTCACGGATGTGGCCCCTGTAAGCTTCTTTCT
  TGTGCTGGATGTAGTCTACCTCGTGTACGAATCAAAGCACTTACATGAGGGGGCAAAGTCAGAGACAGCT
  GAGGAGCTGAAGAAGGTGGCTCAGGAGCTGGAGGAGAAGCTAAACATTCTCAACAATAATTATAAGATTC
  TGCAGGCGGACCAAGAACTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001136541
• ORF Size: 1143 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001136541.1, NP_001130013.1
• RefSeq Size: 2831
• RefSeq ORF: 1143
• Locus ID: 8542
• Protein Families: Secreted Protein, Transmembrane
• Gene Summary: This gene encodes a secreted high density lipoprotein which binds to apolipoprotein A-I. Apolipoprotein A-I is a relatively abundant plasma protein and is the major apoprotein of HDL. It is involved in the formation of most cholesteryl esters in plasma and also promotes efflux of cholesterol from cells. This apolipoprotein L family member may play a role in lipid exchange and transport throughout the body, as well as in reverse cholesterol transport from peripheral cells to the liver. Several different transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
  Transcript Variant: This variant (4) lacks an alternate in-frame 5' coding segment, compared to variant 1. The resulting protein (isoform c) has a shorter N-terminus when it is compared to isoform a. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.