VRK2 (NM_001130483) Human Untagged Clone

CAT#: SC325877

VRK2 (untagged)-Human vaccinia related kinase 2 (VRK2), transcript variant 5


  "NM_001130483" in other vectors (4)

Reconstitution Protocol

USD 680.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "VRK2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol VRK2
Synonyms vaccinia-related kinase-2; vaccinia related kinase 2; vaccinia virus B1R-related kinase 2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001130483, the custom clone sequence may differ by one or more nucleotides


ATGCCACCAAAAAGAAATGAAAAATACAAACTTCCTATTCCATTTCCAGAAGGCAAGGTTCTGGATGATA
TGGAAGGCAATCAGTGGGTACTGGGCAAGAAGATTGGCTCTGGAGGATTTGGATTGATATATTTAGCTTT
CCCCACAAATAAACCAGAGAAAGATGCAAGACATGTAGTAAAAGTGGAATATCAAGAAAATGGCCCGTTA
TTTTCAGAACTTAAATTTTATCAGAGAGTTGCAAAAAAAGACTGTATCAAAAAGTGGATAGAACGCAAAC
AACTTGATTATTTAGGAATTCCTCTGTTTTATGGATCTGGTCTGACTGAATTCAAGGGAAGAAGTTACAG
ATTTATGGTAATGGAAAGACTAGGAATAGATTTACAGAAGATCTCAGGCCAGAATGGTACCTTTAAAAAG
TCAACTGTCCTGCAATTAGGTATCCGAATGTTGGATGTACTGGAATATATACATGAAAATGAATATGTTC
ATGGTGATATAAAAGCAGCAAATCTACTTTTGGGTTACAAAAATCCAGACCAGGTTTATCTTGCAGATTA
TGGACTTTCCTACAGATATTGTCCCAATGGGAACCACAAACAGTATCAGGAAAATCCTAGAAAAGGCCAT
AATGGGACAATAGAGTTTACCAGCTTGGATGCCCACAAGGGAGTAGCCTTGTCCAGACGAAGTGACGTTG
AGATCCTCGGCTACTGCATGCTGCGGTGGTTGTGTGGGAAACTTCCCTGGGAACAGAACCTGAAGGACCC
TGTGGCTGTGCAGACTGCTAAAACAAATCTGTTGGACGAGCTCCCCCAGTCAGTGCTTAAATGGGCTCCT
TCTGGAAGCAGTTGCTGTGAAATAGCCCAATTTTTGGTATGTGCTCATAGTTTAGCATATGATGAAAAGC
CAAACTATCAAGCCCTCAAGAAAATTTTGAACCCTCATGGAATACCTTTAGGACCACTGGACTTTTCCAC
AAAAGGACAGAGTATAAATGTCCATACTCCAAACAGTCAAAAAGTTGATTCACAAAAGGCTGCAACAAAG
CAAGTCAACAAGGCACACAATAGGTTAATCGAAAAAAAAGTCCACAGTGAGAGAAGCGCTGAGTCCTGTG
CAACATGGAAAGTGCAGAAAGAGGAGAAACTGATTGGATTGATGAACAATGAAGCAGCTCAGTTTAGGTA
G


Restriction Sites SgfI-MluI     
ACCN NM_001130483
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001130483.2, NP_001123955.1
RefSeq Size 1988 bp
RefSeq ORF 1191 bp
Locus ID 7444
Cytogenetics 2p16.1
Protein Families Druggable Genome, Protein Kinase, Transmembrane
Gene Summary 'This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. The encoded protein acts as an effector of signaling pathways that regulate apoptosis and tumor cell growth. Variants in this gene have been associated with schizophrenia. Alternative splicing results in multiple transcript variants that differ in their subcellular localization and biological activity. [provided by RefSeq, Jan 2014]'
Transcript Variant: This variant (5) differs in the 5' UTR and contains an alternate exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (3) has a shorter and distinct C-terminus, compared to isoform 1. Variants 5 and 9 encode the same isoform (3, also known as VRK2B).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.