HTR3D (NM_001145143) Human Untagged Clone
CAT#: SC325889
HTR3D (untagged)-Human 5-hydroxytryptamine (serotonin) receptor 3 family member D (HTR3D), transcript variant 1
"NM_001145143" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HTR3D |
Synonyms | 5HT3D |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001145143, the custom clone sequence may differ by one or more nucleotides
ATGGAAAGAGGCTGGTTCCATGGGAAAGGATTCCTCCTTGGCTTCATCCTCCACCTGCTGCTGCAAGATT CACACCTTCAACTGGTGACATCGTTCCTGTGGCTAAATATGTGGAACCCAGATGAATGCGGAGGCATCAA GAAGTCCGGCATGGCAACTGAGAACCTATGGCTTTCAGATGTCTTCATCGAGGAGTCTGTGGATCAGACA CCTGCAGGTCTCATGGCTAGTATGTCAATAGTGAAGGCCACATCAAACACAATAAGCCAATGTGGGTGGT CAGCATCTGCAAACTGGACACCTTCTATTTCCCCTTCCATGGACAGAGGTGAACGCTCTCCTTCAGCCCT TTCACCTACACAGGTAACCCGGGCATGGAGAAGGATGTCCAGGAGCTTTCAAATACATCACAGAACCTCA TTCAGAACAAGGAGGGAGTGGGTACTGCTGGGTATCCAAAAAAGAACAATAAAGGTGACCGTGGCCACTA ACCAGTATGAACAAGCCATCTTCCATGTGGCCATCAGGCGCAGGTGCAGGCCCAGCCCCTACGTGGTAAA CTTTCTGGTGCCCAGTGGCATTCTGATTGCCATCGATGCCCTCAGTTTCTACCTGCCACTGGAAAGTGGG AATTGTGCCCCATTCAAGATGACTGTTCTGCTGGGCTACAGCGTCTTCCTGCTCATGATGAATGACTTGC TCCCAGCCACTAGCACTTCATCACATGCTTCACTAGTACGTCCTCATCCATCAAGAGACCAAAAGCGAGG TGTCTACTTCGCCCTGTGCCTGTCCCTGATGGTGGGCAGCCTGCTGGAGACCATCTTCATCACCCACCTG CTGCACGTGGCCACCACCCAGCCCCTACCTCTGCCTCGGTGGCTCCACTCCCTGCTGCTGCACTGCACCG GCCAAGGGAGATGCTGTCCCACTGCGCCCCAGAAGGGAAATAAGGGCCCGGGTCTCACCCCCACCCACCT GCCCGGTGTGAAGGAGCCAGAGGTATCAGCAGGGCAGATGCCAGGCCCTGGGGAGGCAGAGCTGACAGGG GGCTCAGAATGGACAAGGGCCCAGCGGGAACACGAGGCCCAGAAGCAGCACTCGGTGGAGCTGTGGGTGC AGTTCAGCCACGCGATGGACGCCCTGCTCTTCCGCCTCTACCTGCTCTTCATGGCCTCCTCCATCATCAC CGTCATATGCCTCTGGAACACCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001145143 |
ORF Size | 1215 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001145143.1, NP_001138615.1 |
RefSeq Size | 1609 |
RefSeq ORF | 1215 |
Locus ID | 200909 |
Protein Families | Druggable Genome, Ion Channels: Cys-loop Receptors, Transmembrane |
Gene Summary | The protein encoded this gene belongs to the ligand-gated ion channel receptor superfamily. This gene encodes subunit D of the type 3 receptor for 5-hydroxytryptamine (serotonin), a biogenic hormone that functions as a neurotransmitter, a mitogen and a hormone. This hormone has been linked to neuropsychiatric disorders, including anxiety, depression, and migraine. Serotonin receptors causes fast and depolarizing responses in neurons following activation. The genes encoding subunits C, D and E of this type 3 receptor form a cluster on chromosome 3. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009] Transcript Variant: This variant (1) differs in the 5' coding region, compared to variant 3, resulting in an isoform (1) that is shorter than isoform 3. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227777 | HTR3D (Myc-DDK-tagged)-Human 5-hydroxytryptamine (serotonin) receptor 3 family member D (HTR3D), transcript variant 1 |
USD 420.00 |
|
RG227777 | HTR3D (GFP-tagged) - Human 5-hydroxytryptamine (serotonin) receptor 3 family member D (HTR3D), transcript variant 1 |
USD 460.00 |
|
RC227777L3 | Lenti ORF clone of Human 5-hydroxytryptamine (serotonin) receptor 3 family member D (HTR3D), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC227777L4 | Lenti ORF clone of Human 5-hydroxytryptamine (serotonin) receptor 3 family member D (HTR3D), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review