HTR3D (NM_001145143) Human Untagged Clone

CAT#: SC325889

HTR3D (untagged)-Human 5-hydroxytryptamine (serotonin) receptor 3 family member D (HTR3D), transcript variant 1


  "NM_001145143" in other vectors (4)

Reconstitution Protocol

USD 690.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "HTR3D"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HTR3D
Synonyms 5HT3D
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001145143, the custom clone sequence may differ by one or more nucleotides


ATGGAAAGAGGCTGGTTCCATGGGAAAGGATTCCTCCTTGGCTTCATCCTCCACCTGCTGCTGCAAGATT
CACACCTTCAACTGGTGACATCGTTCCTGTGGCTAAATATGTGGAACCCAGATGAATGCGGAGGCATCAA
GAAGTCCGGCATGGCAACTGAGAACCTATGGCTTTCAGATGTCTTCATCGAGGAGTCTGTGGATCAGACA
CCTGCAGGTCTCATGGCTAGTATGTCAATAGTGAAGGCCACATCAAACACAATAAGCCAATGTGGGTGGT
CAGCATCTGCAAACTGGACACCTTCTATTTCCCCTTCCATGGACAGAGGTGAACGCTCTCCTTCAGCCCT
TTCACCTACACAGGTAACCCGGGCATGGAGAAGGATGTCCAGGAGCTTTCAAATACATCACAGAACCTCA
TTCAGAACAAGGAGGGAGTGGGTACTGCTGGGTATCCAAAAAAGAACAATAAAGGTGACCGTGGCCACTA
ACCAGTATGAACAAGCCATCTTCCATGTGGCCATCAGGCGCAGGTGCAGGCCCAGCCCCTACGTGGTAAA
CTTTCTGGTGCCCAGTGGCATTCTGATTGCCATCGATGCCCTCAGTTTCTACCTGCCACTGGAAAGTGGG
AATTGTGCCCCATTCAAGATGACTGTTCTGCTGGGCTACAGCGTCTTCCTGCTCATGATGAATGACTTGC
TCCCAGCCACTAGCACTTCATCACATGCTTCACTAGTACGTCCTCATCCATCAAGAGACCAAAAGCGAGG
TGTCTACTTCGCCCTGTGCCTGTCCCTGATGGTGGGCAGCCTGCTGGAGACCATCTTCATCACCCACCTG
CTGCACGTGGCCACCACCCAGCCCCTACCTCTGCCTCGGTGGCTCCACTCCCTGCTGCTGCACTGCACCG
GCCAAGGGAGATGCTGTCCCACTGCGCCCCAGAAGGGAAATAAGGGCCCGGGTCTCACCCCCACCCACCT
GCCCGGTGTGAAGGAGCCAGAGGTATCAGCAGGGCAGATGCCAGGCCCTGGGGAGGCAGAGCTGACAGGG
GGCTCAGAATGGACAAGGGCCCAGCGGGAACACGAGGCCCAGAAGCAGCACTCGGTGGAGCTGTGGGTGC
AGTTCAGCCACGCGATGGACGCCCTGCTCTTCCGCCTCTACCTGCTCTTCATGGCCTCCTCCATCATCAC
CGTCATATGCCTCTGGAACACCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001145143
ORF Size 1215 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001145143.1, NP_001138615.1
RefSeq Size 1609
RefSeq ORF 1215
Locus ID 200909
Protein Families Druggable Genome, Ion Channels: Cys-loop Receptors, Transmembrane
Gene Summary The protein encoded this gene belongs to the ligand-gated ion channel receptor superfamily. This gene encodes subunit D of the type 3 receptor for 5-hydroxytryptamine (serotonin), a biogenic hormone that functions as a neurotransmitter, a mitogen and a hormone. This hormone has been linked to neuropsychiatric disorders, including anxiety, depression, and migraine. Serotonin receptors causes fast and depolarizing responses in neurons following activation. The genes encoding subunits C, D and E of this type 3 receptor form a cluster on chromosome 3. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
Transcript Variant: This variant (1) differs in the 5' coding region, compared to variant 3, resulting in an isoform (1) that is shorter than isoform 3. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.