EGR2 (NM_001136179) Human Untagged Clone

CAT#: SC325914

EGR2 (untagged)-Human early growth response 2 (EGR2), transcript variant 4


  "NM_001136179" in other vectors (4)

Reconstitution Protocol

USD 720.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "EGR2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol EGR2
Synonyms AT591; CHN1; CMT1D; CMT4E; KROX20
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001136179, the custom clone sequence may differ by one or more nucleotides


ATGAACGGAGTGGCCGGAGATGGCATGATCAACATTGACATGACTGGAGAGAAGAGGTCGTTGGATCTCC
CATATCCCAGCAGCTTTGCTCCCGTCTCTGCACCTAGAAACCAGACCTTCACTTACATGGGCAAGTTCTC
CATTGACCCTCAGTACCCTGGTGCCAGCTGCTACCCAGAAGGCATAATCAATATTGTGAGTGCAGGCATC
TTGCAAGGGGTCACTTCCCCAGCTTCAACCACAGCCTCATCCAGCGTCACCTCTGCCTCCCCCAACCCAC
TGGCCACAGGACCCCTGGGTGTGTGCACCATGTCCCAGACCCAGCCTGACCTGGACCACCTGTACTCTCC
GCCACCGCCTCCTCCTCCTTATTCTGGCTGTGCAGGAGACCTCTACCAGGACCCTTCTGCGTTCCTGTCA
GCAGCCACCACCTCCACCTCTTCCTCTCTGGCCTACCCACCACCTCCTTCCTATCCATCCCCCAAGCCAG
CCACGGACCCAGGTCTCTTCCCAATGATCCCAGACTATCCTGGATTCTTTCCATCTCAGTGCCAGAGAGA
CCTACATGGTACAGCTGGCCCAGACCGTAAGCCCTTTCCCTGCCCACTGGACACCCTGCGGGTGCCCCCT
CCACTCACTCCACTCTCTACAATCCGTAACTTTACCCTGGGGGGCCCCAGTGCTGGGGTGACCGGACCAG
GGGCCAGTGGAGGCAGCGAGGGACCCCGGCTGCCTGGTAGCAGCTCAGCAGCAGCAGCAGCCGCCGCCGC
CGCCGCCTATAACCCACACCACCTGCCACTGCGGCCCATTCTGAGGCCTCGCAAGTACCCCAACAGACCC
AGCAAGACGCCGGTGCACGAGAGGCCCTACCCGTGCCCAGCAGAAGGCTGCGACCGGCGGTTCTCCCGCT
CTGACGAGCTGACACGGCACATCCGAATCCACACTGGGCATAAGCCCTTCCAGTGTCGGATCTGCATGCG
CAACTTCAGCCGCAGTGACCACCTCACCACCCATATCCGCACCCACACCGGTGAGAAGCCCTTCGCCTGT
GACTACTGTGGCCGAAAGTTTGCCCGGAGTGATGAGAGGAAGCGCCACACCAAGATCCACCTGAGACAGA
AAGAGCGGAAAAGCAGTGCCCCCTCTGCATCGGTGCCAGCCCCCTCTACAGCCTCCTGCTCTGGGGGCGT
GCAGCCTGGGGGTACCCTGTGCAGCAGTAACAGCAGCAGTCTTGGCGGAGGGCCGCTCGCCCCTTGCTCC
TCTCGGACCCGGACACCTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001136179
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001136179.2, NP_001129651.1
RefSeq Size 2906 bp
RefSeq ORF 1281 bp
Locus ID 1959
Cytogenetics 10q21.3
Protein Families Druggable Genome, Transcription Factors
Gene Summary 'The protein encoded by this gene is a transcription factor with three tandem C2H2-type zinc fingers. Defects in this gene are associated with Charcot-Marie-Tooth disease type 1D (CMT1D), Charcot-Marie-Tooth disease type 4E (CMT4E), and with Dejerine-Sottas syndrome (DSS). Multiple transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]'
Transcript Variant: This variant (4) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Both variants 4 and 5 encode the same isoform (b).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.