CRF1 (CRHR1) (NM_001145146) Human Untagged Clone
CAT#: SC325932
CRHR1 (untagged)-Human corticotropin releasing hormone receptor 1 (CRHR1), transcript variant 1
"NM_001145146" in other vectors (6)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | CRHR1 |
| Synonyms | CRF-R; CRF-R-1; CRF-R1; CRF1; CRFR-1; CRFR1; CRH-R-1; CRH-R1; CRHR; CRHR1L |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001145146, the custom clone sequence may differ by one or more nucleotides
ATGGGAGGGCACCCGCAGCTCCGTCTCGTCAAGGCCCTTCTCCTTCTGGGGCTGAACCCCGTCTCTGCCT CCCTCCAGGACCAGCACTGCGAGAGCCTGTCCCTGGCCAGCAACATCTCAGGACTGCAGTGCAACGCATC CGTGGACCTCATTGGCACCTGCTGGCCCCGCAGCCCTGCGGGGCAGCTAGTGGTTCGGCCCTGCCCTGCC TTTTTCTATGGTGTCCGCTACAATACCACAAACAATGGCTACCGGGAGTGCCTGGCCAATGGCAGCTGGG CCGCCCGCGTGAATTACTCCGAGTGCCAGGAGATCCTCAATGAGGAGAAAAAAAGCAAGGTGCACTACCA TGTCGCAGTCATCATCAACTACCTGGGCCACTGTATCTCCCTGGTGGCCCTCCTGGTGGCCTTTGTCCTC TTTCTGCGGCTCAGGCCAGGCTGCACCCATTGGGGTGACCAGGCAGATGGAGCCCTGGAGGTGGGGGCTC CATGGAGTGGTGCCCCATTTCAGGTTCGAAGGAGCATCCGGTGCCTGCGAAACATCATCCACTGGAACCT CATCTCCGCCTTCATCCTGCGCAACGCCACCTGGTTCGTGGTCCAGCTAACCATGAGCCCCGAGGTCCAC CAGAGCAACGTGGGCTGGTGCAGGTTGGTGACAGCCGCCTACAACTACTTCCATGTGACCAACTTCTTCT GGATGTTCGGCGAGGGCTGCTACCTGCACACAGCCATCGTGCTCACCTACTCCACTGACCGGCTGCGCAA ATGGATGTTCATCTGCATTGGCTGGGGTGTGCCCTTCCCCATCATTGTGGCCTGGGCCATTGGGAAGCTG TACTACGACAATGAGAAGTGCTGGTTTGGCAAAAGGCCTGGGGTGTACACCGACTACATCTACCAGGGCC CCATGATCCTGGTCCTGCTGATCAATTTCATCTTCCTTTTCAACATCGTCCGCATCCTCATGACCAAGCT CCGGGCATCCACCACGTCTGAGACCATTCAGTACAGGAAGGCTGTGAAAGCCACTCTGGTGCTGCTGCCC CTCCTGGGCATCACCTACATGCTGTTCTTCGTCAATCCCGGGGAGGATGAGGTCTCCCGGGTCGTCTTCA TCTACTTCAACTCCTTCCTGGAATCCTTCCAGGGCTTCTTTGTGTCTGTGTTCTACTGTTTCCTCAATAG TGAGGTCCGTTCTGCCATCCGGAAGAGGTGGCACCGGTGGCAGGACAAGCACTCGATCCGTGCCCGAGTG GCCCGTGCCATGTCCATCCCCACCTCCCCAACCCGTGTCAGCTTTCACAGCATCAAGCAGTCCACAGCAG TCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001145146 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001145146.1, NP_001138618.1 |
| RefSeq Size | 2681 bp |
| RefSeq ORF | 1335 bp |
| Locus ID | 1394 |
| Cytogenetics | 17q21.31 |
| Protein Families | Druggable Genome, GPCR, Transmembrane |
| Protein Pathways | Long-term depression, Neuroactive ligand-receptor interaction |
| Gene Summary | 'This gene encodes a G-protein coupled receptor that binds neuropeptides of the corticotropin releasing hormone family that are major regulators of the hypothalamic-pituitary-adrenal pathway. The encoded protein is essential for the activation of signal transduction pathways that regulate diverse physiological processes including stress, reproduction, immune response and obesity. Alternative splicing results in multiple transcript variants. Naturally-occurring readthrough transcription between this gene and upstream GeneID:147081 results in transcripts that encode isoforms that share similarity with the products of this gene. [provided by RefSeq, Aug 2016]' Transcript Variant: This variant (1b, also known as CRH-R1beta), represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC226816 | CRHR1 (Myc-DDK-tagged)-Human corticotropin releasing hormone receptor 1 (CRHR1), transcript variant 1 |
USD 457.00 |
|
| RG226816 | CRHR1 (GFP-tagged) - Human corticotropin releasing hormone receptor 1 (CRHR1), transcript variant 1 |
USD 460.00 |
|
| RC226816L1 | Lenti ORF clone of Human corticotropin releasing hormone receptor 1 (CRHR1), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
| RC226816L2 | Lenti ORF clone of Human corticotropin releasing hormone receptor 1 (CRHR1), transcript variant 1, mGFP tagged |
USD 768.00 |
|
| RC226816L3 | Lenti ORF clone of Human corticotropin releasing hormone receptor 1 (CRHR1), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
| RC226816L4 | Lenti ORF clone of Human corticotropin releasing hormone receptor 1 (CRHR1), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China