MDM2 (NM_001145337) Human Untagged Clone
CAT#: SC325933
MDM2 (untagged)-Human Mdm2 p53 binding protein homolog (mouse) (MDM2), transcript variant MDM2g
"NM_001145337" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MDM2 |
Synonyms | ACTFS; hdm2; HDMX |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001145337, the custom clone sequence may differ by one or more nucleotides
ATGTGCAATACCAACATGTCTGTACCTACTGATGGTGCTGTAACCACCTCACAGATTCCAGCTTCGGAAC AAGAGACCCTGGTTAGACCAAAGCCATTGCTTTTGAAGTTATTAAAGTCTGTTGGTGCACAAAAAGACAC TTATACTATGAAAGAGGTTCTTTTTTATCTTGGCCAGTATATTATGACTAAACGATTATATGATGAGAAG CAACAACATATTGTATATTGTTCAAATGATCTTCTAGGAGATTTGTTTGGCGTGCCAAGCTTCTCTGTGA AAGAGCACAGGAAAATATATACCATGATCTACAGGAACTTGGTAGTAGTCAATCAGCAGGAATCATCGGA CTCAGGTACATCTGTGAGTGAGAACAGGTGTCACCTTGAAGGTGGGAGTGATCAAAAGGACCTTGTACAA GAGCTTCAGGAAGAGAAACCTTCATCTTCACATTTGGTTTCTAGACCATCTACCTCATCTAGAAGGAGAG CAATTAGTGAGACAGAAGAAAATTCAGATGAATTATCTGGTGAACGACAAAGAAAACGCCACAAATCTGA TAGTATTTCCCTTTCCTTTGATGAAAGCCTGGCTCTGTGTGTAATAAGGGAGATATGTTGTGAAAGAAGC AGTAGCAGTGAATCTACAGGGACGCCATCGAATCCGGATCTTGATGCTGGTGTATATCAAGTTACTGTGT ATCAGGCAGGGGAGAGTGATACAGATTCATTTGAAGAAGATCCTGAAATTTCCTTAGCTGACTATTGGAA ATGCACTTCATGCAATGAAATGAATCCCCCCCTTCCATCACATTGCAACAGATGTTGGGCCCTTCGTGAG AATTGGCTTCCTGAAGATAAAGGGAAAGATAAAGGGGAAATCTCTGAGAAAGCCAAACTGGAAAACTCAA CACAAGCTGAAGAGGGCTTTGATGTTCCTGATTGTAAAAAAACTATAGTGAATGATTCCAGAGAGTCATG TGTTGAGGAAAATGATGATAAAATTACACAAGCTTCACAATCACAAGAAAGTGAAGACTATTCTCAGCCA TCAACTTCTAGTAGCATTATTTATAGCAGCCAAGAAGATGTGAAAGAGTTTGAAAGGGAAGAAACCCAAG ACAAAGAAGAGAGTGTGGAATCTAGTTTGCCCCTTAATGCCATTGAACCTTGTGTGATTTGTCAAGGTCG ACCTAAAAATGGTTGCATTGTCCATGGCAAAACAGGACATCTTATGGCCTGCTTTACATGTGCAAAGAAG CTAAAGAAAAGGAATAAGCCCTGCCCAGTATGTAGACAACCAATTCAAATGATTGTGCTAACTTATTTCC CCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001145337 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001145337.2, NP_001138809.1 |
RefSeq Size | 7104 bp |
RefSeq ORF | 1335 bp |
Locus ID | 4193 |
Cytogenetics | 12q15 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Bladder cancer, Cell cycle, Chronic myeloid leukemia, Endocytosis, Glioma, Melanoma, p53 signaling pathway, Pathways in cancer, Prostate cancer, Ubiquitin mediated proteolysis |
Gene Summary | 'This gene encodes a nuclear-localized E3 ubiquitin ligase. The encoded protein can promote tumor formation by targeting tumor suppressor proteins, such as p53, for proteasomal degradation. This gene is itself transcriptionally-regulated by p53. Overexpression or amplification of this locus is detected in a variety of different cancers. There is a pseudogene for this gene on chromosome 2. Alternative splicing results in a multitude of transcript variants, many of which may be expressed only in tumor cells. [provided by RefSeq, Jun 2013]' Transcript Variant: This variant (3, also known as P2-MDM2-10) contains multiple differences in the 5' UTR and coding region, compared to variant 1. It uses an alternate promoter and initiates translation at a downstream in-frame start codon. The encoded isoform (g) has a shorter N-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227519 | Myc-DDK-tagged ORF clone of Homo sapiens Mdm2 p53 binding protein homolog (mouse) (MDM2), transcript variant MDM2g as transfection-ready DNA |
USD 420.00 |
|
RG227519 | MDM2 (GFP-tagged) - Human Mdm2 p53 binding protein homolog (mouse) (MDM2), transcript variant MDM2g |
USD 460.00 |
|
RC227519L3 | Lenti-ORF clone of Myc-DDK-tagged ORF clone of Homo sapiens Mdm2 p53 binding protein homolog (mouse) (MDM2), transcript variant MDM2g as transfection-ready DNA |
USD 620.00 |
|
RC227519L4 | Lenti-ORF clone of mGFP-tagged ORF clone of Homo sapiens Mdm2 p53 binding protein homolog (mouse) (MDM2), transcript variant MDM2g as transfection-ready DNA |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review