MEF2C (NM_001131005) Human Untagged Clone

CAT#: SC325962

MEF2C (untagged)-Human myocyte enhancer factor 2C (MEF2C), transcript variant 2


  "NM_001131005" in other vectors (4)

Reconstitution Protocol

USD 780.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "MEF2C"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MEF2C
Synonyms C5DELq14.3; DEL5q14.3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001131005 edited
ATGGGGAGAAAAAAGATTCAGATTACGAGGATTATGGATGAACGTAACAGACAGGTGACA
TTTACAAAGAGGAAATTTGGGTTGATGAAGAAGGCTTATGAGCTGAGCGTGCTGTGTGAC
TGTGAGATTGCGCTGATCATCTTCAACAGCACCAACAAGCTGTTCCAGTATGCCAGCACC
GACATGGACAAAGTGCTTCTCAAGTACACGGAGTACAACGAGCCGCATGAGAGCCGGACA
AACTCAGACATCGTGGAGGCATTGAACAAGAAAGAAAACAAAGGCTGTGAAAGCCCCGAT
CCCGACTCCTCTTATGCACTCACCCCACGCACTGAAGAAAAATACAAAAAAATTAATGAA
GAATTTGATAATATGATCAAGAGTCATAAAATTCCTGCTGTTCCACCTCCCAACTTCGAG
ATGCCAGTCTCCATCCCAGTGTCCAGCCACAACAGTTTGGTGTACAGCAACCCTGTCAGC
TCACTGGGAAACCCCAACCTATTGCCACTGGCTCACCCTTCTCTGCAGAGGAATAGTATG
TCTCCTGGTGTAACACATCGACCTCCAAGTGCAGGTAACACAGGTGGTCTGATGGGTGGA
GACCTCACGTCTGGTGCAGGCACCAGTGCAGGGAACGGGTATGGCAATCCCCGAAACTCA
CCAGGTCTGCTGGTCTCACCTGGTAACTTGAACAAGAATATGCAAGCAAAATCTCCTCCC
CCAATGAATTTAGGAATGAATAACCGTAAACCAGATCTCCGAGTTCTTATTCCACCAGGC
AGCAAGAATACGATGCCATCAGTGAATCAAAGGATAAATAACTCCCAGTCGGCTCAGTCA
TTGGCTACCCCAGTGGTTTCCGTAGCAACTCCTACTTTACCAGGACAAGGAATGGGAGGA
TATCCATCAGCCATTTCAACAACATATGGTACCGAGTACTCTCTGAGTAGTGCAGACCTG
TCATCTCTGTCTGGGTTTAACACCGCCAGCGCTCTTCACCTTGGTTCAGTAACTGGCTGG
CAACAGCAACACCTACATAACATGCCACCATCTGCCCTCAGTCAGTTGGGAGCTTGCACT
AGCACTCATTTATCTCAGAGTTCAAATCTCTCCCTGCCTTCTACTCAAAGCCTCAACATC
AAGTCAGAACCTGTTTCTCCTCCTAGAGACCGTACCACCACCCCTTCGAGATACCCACAA
CACACGCGCCACGAGGCGGGGAGATCTCCTGTTGACAGCTTGAGCAGCTGTAGCAGTTCG
TACGACGGGAGCGACCGAGAGGATCACCGGAACGAATTCCACTCCCCCATTGGACTCACC
AGACCTTCGCCGGACGAAAGGGAAAGTCCCTCAGTCAAGCGCATGCGACTTTCTGAAGGA
TGGGCAACATGA
Restriction Sites Please inquire     
ACCN NM_001131005
Insert Size 1500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001131005.1.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001131005.1, NP_001124477.1
RefSeq Size 6131 bp
RefSeq ORF 1392 bp
Locus ID 4208
Cytogenetics 5q14.3
Protein Families Transcription Factors
Protein Pathways MAPK signaling pathway
Gene Summary 'This locus encodes a member of the MADS box transcription enhancer factor 2 (MEF2) family of proteins, which play a role in myogenesis. The encoded protein, MEF2 polypeptide C, has both trans-activating and DNA binding activities. This protein may play a role in maintaining the differentiated state of muscle cells. Mutations and deletions at this locus have been associated with severe cognitive disability, stereotypic movements, epilepsy, and cerebral malformation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2010]'
Transcript Variant: This variant (2) differs in the 5' UTR and has multiple differences in the coding region but maintains the reading frame, compared to variant 1. This variant encodes isoform 2, which is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.