ETS1 (NM_001143820) Human Untagged Clone

CAT#: SC325981

ETS1 (untagged)-Human v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1), transcript variant 1


  "NM_001143820" in other vectors (6)

Reconstitution Protocol

USD 820.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "ETS1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ETS1
Synonyms c-ets-1; ETS-1; EWSR2; p54
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001143820 edited
ATGAGCTACTTTGTGGATTCTGCTGGGAGCAGCCCCGTCCCTTACTCAGCGCCTCGTCCT
GCAGTGGTGAGGCAAGGACCTAGCAACACTTATGAAGATCCTCGAATGAACTGTGGTTTC
CAGTCCAATTATCACCAGCAAAGACCTTGCTACCCCTTTTGGGATGAGATGGCAACTCAG
GAAGTTCCTACTGGTCTTGAACACTGTGTCTCAGATATGGAATGTGCAGATGTCCCACTA
TTAACTCCAAGCAGCAAAGAAATGATGTCTCAAGCATTAAAAGCTACTTTCAGTGGTTTC
ACTAAAGAACAGCAACGACTGGGGATCCCAAAAGACCCCCGGCAGTGGACAGAAACCCAT
GTTCGGGACTGGGTGATGTGGGCTGTGAATGAATTCAGCCTGAAAGGTGTAGACTTCCAG
AAGTTCTGTATGAATGGAGCAGCCCTCTGCGCCCTGGGTAAAGACTGCTTTCTCGAGCTG
GCCCCAGACTTTGTTGGGGACATCTTATGGGAACATCTAGAGATCCTGCAGAAAGAGGAT
GTGAAACCATATCAAGTTAATGGAGTCAACCCAGCCTATCCAGAATCCCGCTATACCTCG
GATTACTTCATTAGCTATGGTATTGAGCATGCCCAGTGTGTTCCACCATCGGAGTTCTCA
GAGCCCAGCTTCATCACAGAGTCCTATCAGACGCTCCATCCCATCAGCTCGGAAGAGCTC
CTCTCCCTCAAGTATGAGAATGACTACCCCTCGGTCATTCTCCGAGACCCTCTCCAGACA
GACACCTTGCAGAATGACTACTTTGCTATCAAACAAGAAGTCGTCACCCCAGACAACATG
TGCATGGGGAGGACCAGTCGTGGTAAACTCGGGGGCCAGGACTCTTTTGAAAGCATAGAG
AGCTACGATAGTTGTGATCGCCTCACCCAGTCCTGGAGCAGCCAGTCATCTTTCAACAGC
CTGCAGCGTGTTCCCTCCTATGACAGCTTCGACTCAGAGGACTATCCGGCTGCCCTGCCC
AACCACAAGCCCAAGGGCACCTTCAAGGACTATGTGCGGGACCGTGCTGACCTCAATAAG
GACAAGCCTGTCATTCCTGCTGCTGCCCTAGCTGGCTACACAGGCAGTGGACCAATCCAG
CTATGGCAGTTTCTTCTGGAATTACTCACTGATAAATCCTGTCAGTCTTTTATCAGCTGG
ACAGGAGATGGCTGGGAATTCAAACTTTCTGACCCAGATGAGGTGGCCAGGAGATGGGGA
AAGAGGAAAAACAAACCTAAGATGAATTATGAGAAACTGAGCCGTGGCCTACGCTACTAT
TACGACAAAAACATCATCCACAAGACAGCGGGGAAACGCTACGTGTACCGCTTTGTGTGT
GACCTGCAGAGCCTGCTGGGGTACACCCCTGAGGAGCTGCACGCCATGCTGGACGTCAAG
CCAGATGCCGACGAGTGA
Restriction Sites Please inquire     
ACCN NM_001143820
Insert Size 5100 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001143820.1, NP_001137292.1
RefSeq Size 5143 bp
RefSeq ORF 1458 bp
Locus ID 2113
Cytogenetics 11q24.3
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Dorso-ventral axis formation, Pathways in cancer, Renal cell carcinoma
Gene Summary 'This gene encodes a member of the ETS family of transcription factors, which are defined by the presence of a conserved ETS DNA-binding domain that recognizes the core consensus DNA sequence GGAA/T in target genes. These proteins function either as transcriptional activators or repressors of numerous genes, and are involved in stem cell development, cell senescence and death, and tumorigenesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]'
Transcript Variant: This variant (1) encodes the longest isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.