ERG (NM_001136154) Human Untagged Clone

CAT#: SC325982

ERG (untagged)-Human v-ets erythroblastosis virus E26 oncogene homolog (avian) (ERG), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ERG
• Synonyms: erg-3; p55
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001136154 edited
  ATGATTCAGACTGTCCCGGACCCAGCAGCTCATATCAAGGAAGCCTTATCAGTTGTGAGT
  GAGGACCAGTCGTTGTTTGAGTGTGCCTACGGAACGCCACACCTGGCTAAGACAGAGATG
  ACCGCGTCCTCCTCCAGCGACTATGGACAGACTTCCAAGATGAGCCCACGCGTCCCTCAG
  CAGGATTGGCTGTCTCAACCCCCAGCCAGGGTCACCATCAAAATGGAATGTAACCCTAGC
  CAGGTGAATGGCTCAAGGAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATG
  GTGGGCAGCCCAGACACCGTTGGGATGAACTACGGCAGCTACATGGAGGAGAAGCACATG
  CCACCCCCAAACATGACCACGAACGAGCGCAGAGTTATCGTGCCAGCAGATCCTACGCTA
  TGGAGTACAGACCATGTGCGGCAGTGGCTGGAGTGGGCGGTGAAAGAATATGGCCTTCCA
  GACGTCAACATCTTGTTATTCCAGAACATCGATGGGAAGGAACTGTGCAAGATGACCAAG
  GACGACTTCCAGAGGCTCACCCCCAGCTACAATGCCGACATCCTTCTCTCACATCTCCAC
  TACCTCAGAGAGACTCCTCTTCCACATTTGACTTCAGATGATGTTGATAAAGCCTTACAA
  AACTCTCCACGGTTAATGCATGCTAGAAACACAGGGGGTGCAGCTTTTATTTTCCCAAAT
  ACTTCAGTATATCCTGAAGCTACGCAAAGAATTACAACTAGGCCAGATTTACCATATGAG
  CCCCCCAGGAGATCAGCCTGGACCGGTCACGGCCACCCCACGCCCCAGTCGAAAGCTGCT
  CAACCATCTCCTTCCACAGTGCCCAAAACTGAAGACCAGCGTCCTCAGTTAGATCCTTAT
  CAGATTCTTGGACCAACAAGTAGCCGCCTTGCAAATCCAGGCAGTGGCCAGATCCAGCTT
  TGGCAGTTCCTCCTGGAGCTCCTGTCGGACAGCTCCAACTCCAGCTGCATCACCTGGGAA
  GGCACCAACGGGGAGTTCAAGATGACGGATCCCGACGAGGTGGCCCGGCGCTGGGGAGAG
  CGGAAGAGCAAACCCAACATGAACTACGATAAGCTCAGCCGCGCCCTCCGTTACTACTAT
  GACAAGAACATCATGACCAAGGTCCATGGGAAGCGCTACGCCTACAAGTTCGACTTCCAC
  GGGATCGCCCAGGCCCTCCAGCCCCACCCCCCGGAGTCATCTCTGTACAAGTACCCCTCA
  GACCTCCCGTACATGGGCTCCTATCACGCCCACCCACAGAAGATGAACTTTGTGGCGCCC
  CACCCTCCAGCCCTCCCCGTGACATCTTCCAGTTTTTTTGCTGCCCCAAACCCATACTGG
  AATTCACCAACTGGGGGTATATACCCCAACACTAGGCTCCCCACCAGCCATATGCCTTCT
  CATCTGGGCACTTACTACTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_001136154
• Insert Size: 1500 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001136154.1, NP_001129626.1
• RefSeq Size: 5114 bp
• RefSeq ORF: 1461 bp
• Locus ID: 2078
• Cytogenetics: 21q22.2
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: 'This gene encodes a member of the erythroblast transformation-specific (ETS) family of transcriptions factors. All members of this family are key regulators of embryonic development, cell proliferation, differentiation, angiogenesis, inflammation, and apoptosis. The protein encoded by this gene is mainly expressed in the nucleus. It contains an ETS DNA-binding domain and a PNT (pointed) domain which is implicated in the self-association of chimeric oncoproteins. This protein is required for platelet adhesion to the subendothelium, inducing vascular cell remodeling. It also regulates hematopoesis, and the differentiation and maturation of megakaryocytic cells. This gene is involved in chromosomal translocations, resulting in different fusion gene products, such as TMPSSR2-ERG and NDRG1-ERG in prostate cancer, EWS-ERG in Ewing's sarcoma and FUS-ERG in acute myeloid leukemia. More than two dozens of transcript variants generated from combinatorial usage of three alternative promoters and multiple alternative splicing events have been reported, but the full-length nature of many of these variants has not been determined. [provided by RefSeq, Apr 2014]'
  Transcript Variant: This variant (3) and variant 5 encode the longest protein (isoform 3). Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.