PAX7 (NM_001135254) Human Untagged Clone
CAT#: SC326000
PAX7 (untagged)-Human paired box 7 (PAX7), transcript variant 3
"NM_001135254" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PAX7 |
Synonyms | HUP1; PAX7B; RMS2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001135254, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCCCTTCCCGGCACGGTACCGAGAATGATGCGGCCGGCTCCGGGGCAGAACTACCCCCGCACGG GATTCCCTTTGGAAGTGTCCACCCCGCTTGGCCAAGGCCGGGTCAATCAGCTGGGAGGGGTCTTCATCAA TGGGCGACCCCTGCCTAACCACATCCGCCACAAGATAGTGGAGATGGCCCACCATGGCATCCGGCCCTGT GTCATCTCCCGACAGCTGCGTGTCTCCCACGGCTGCGTCTCCAAGATTCTTTGCCGCTACCAGGAGACCG GGTCCATCCGGCCTGGGGCCATCGGCGGCAGCAAGCCCAGACAGGTGGCGACTCCGGATGTAGAGAAAAA GATTGAGGAGTACAAGAGGGAAAACCCAGGCATGTTCAGCTGGGAGATCCGGGACAGGCTGCTGAAGGAT GGGCACTGTGACCGAAGCACTGTGCCCTCAGGTTTAGTGAGTTCGATTAGCCGCGTGCTCAGAATCAAGT TCGGGAAGAAAGAGGAGGAGGATGAAGCGGACAAGAAGGAGGACGACGGCGAAAAGAAGGCCAAACACAG CATCGACGGCATCCTGGGCGACAAAGGGAACCGGCTGGACGAGGGCTCGGATGTGGAGTCGGAACCTGAC CTCCCACTGAAGCGCAAGCAGCGACGCAGTCGGACCACATTCACGGCCGAGCAGCTGGAGGAGCTGGAGA AGGCCTTTGAGAGGACCCACTACCCAGACATATACACCCGCGAGGAGCTGGCGCAGAGGACCAAGCTGAC AGAGGCGCGTGTGCAGGTCTGGTTCAGTAACCGCCGCGCCCGTTGGCGTAAGCAGGCAGGAGCCAACCAG CTGGCGGCGTTCAACCACCTTCTGCCAGGAGGCTTCCCACCCACCGGCATGCCCACGCTGCCCCCCTACC AGCTGCCGGACTCCACCTACCCCACCACCACCATCTCCCAAGATGGGGGCAGCACTGTGCACCGGCCTCA GCCCCTGCCACCGTCCACCATGCACCAGGGCGGGCTGGCTGCAGCGGCTGCAGCCGCCGACACCAGCTCT GCCTACGGAGCCCGCCACAGCTTCTCCAGCTACTCTGACAGCTTCATGAATCCGGCGGCGCCCTCCAACC ACATGAACCCGGTCAGCAACGGCCTGTCTCCTCAGGTGATGAGCATCTTGGGCAACCCCAGTGCGGTGCC CCCGCAGCCACAGGCTGACTTCTCCATCTCCCCGCTGCATGGCGGCCTGGACTCGGCCACCTCCATCTCA GCCAGCTGCAGCCAGCGGGCCGACTCCATCAAGCCAGGAGACAGCCTGCCCACCTCCCAGGCCTACTGCC CACCCACCTACAGCACCACCGGCTACAGCGTGGACCCCGTGGCCGGCTATCAGTACGGCCAGTACGGCCA GACTGCTGTTGATTATCTGGCCAAAAATGTGAGCCTCTCCACCCAGCGTCGCATGAAGCTCGGGGAGCAC TCTGCTGTGCTGGGACTCCTGCCTGTGGAAACTGGCCAGGCCTACTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001135254 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001135254.1, NP_001128726.1 |
RefSeq Size | 6053 bp |
RefSeq ORF | 1518 bp |
Locus ID | 5081 |
Cytogenetics | 1p36.13 |
Protein Families | Adult stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Transcription Factors |
Gene Summary | 'This gene is a member of the paired box (PAX) family of transcription factors. Members of this gene family typically contain a paired box domain, an octapeptide, and a paired-type homeodomain. These genes play critical roles during fetal development and cancer growth. The specific function of the paired box 7 gene is unknown but speculated to involve tumor suppression since fusion of this gene with a forkhead domain family member has been associated with alveolar rhabdomyosarcoma. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]' Transcript Variant: This variant (3) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225868 | PAX7 (Myc-DDK-tagged)-Human paired box 7 (PAX7), transcript variant 3 |
USD 470.00 |
|
RG225868 | PAX7 (GFP-tagged) - Human paired box 7 (PAX7), transcript variant 3 |
USD 520.00 |
|
RC225868L3 | Lenti-ORF clone of PAX7 (Myc-DDK-tagged)-Human paired box 7 (PAX7), transcript variant 3 |
USD 670.00 |
|
RC225868L4 | Lenti-ORF clone of PAX7 (mGFP-tagged)-Human paired box 7 (PAX7), transcript variant 3 |
USD 670.00 |
{0} Product Review(s)
Be the first one to submit a review