HOPX (NM_001145459) Human Untagged Clone

CAT#: SC326443

HOPX (untagged)-Human HOP homeobox (HOPX), transcript variant 4, mRNA

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HOPX
• Synonyms: CAMEO; HOD; HOP; LAGY; NECC1; OB1; SMAP31; TOTO
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001145459, the custom clone sequence may differ by one or more nucleotides
  ATGTCGGCGGAGACCGCGAGCGGCCCCACAGAGGACCAGGTGGAAATCCTGGAGTACAAC
  TTCAACAAGGTCGACAAGCACCCGGATTCCACCACGCTGTGCCTCATCGCGGCCGAGGCA
  GGCCTTTCCGAGGAGGAGACCCAGAAATGGTTTAAGCAGCGCCTGGCAAAGTGGCGGCGC
  TCAGAAGGCCTGCCCTCAGAGTGCAGATCCGTCACAGAC
  
• Restriction Sites: Please inquire
• ACCN: NM_001145459
• ORF Size: 222 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001145459.1, NP_001138931.1
• RefSeq Size: 1198
• RefSeq ORF: 222
• Locus ID: 84525
• Protein Families: Transcription Factors
• Gene Summary: The protein encoded by this gene is a homeodomain protein that lacks certain conserved residues required for DNA binding. It was reported that choriocarcinoma cell lines and tissues failed to express this gene, which suggested the possible involvement of this gene in malignant conversion of placental trophoblasts. Studies in mice suggest that this protein may interact with serum response factor (SRF) and modulate SRF-dependent cardiac-specific gene expression and cardiac development. Multiple alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Feb 2009]
  Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region and uses a downstream translational start codon, compared to variant 1. The resulting isoform (b) is shorter at the N-terminus, compared to isoform a. Variants 2, 3 and 4 encode the same isoform.