PAFAH1B3 (NM_001145939) Human Untagged Clone

CAT#: SC326453

PAFAH1B3 (untagged)-Human platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDa (PAFAH1B3), transcript variant 1, mRNA


  "NM_001145939" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "PAFAH1B3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PAFAH1B3
Synonyms PAFAHG
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001145939 edited
CGGGAAGCGCCGGGCGAGCCCACTGTGCGGCCGTCGTGGGGGAAGCGAAGGTTCCTGATT
CCACCTACCTCCTAAGTGAAGGCTTCCGTCCCTGGAGAGGAGGCGGCGCCCTGTATCGGC
CTTCGTCCTCCGCGGGTGTGCTAGCGTTGGGACGGTCCTTTGTTGCCGCGAGGGGTAGGA
GTGGGCGTGGCGGAGCCAGCTCCGTTCGGAACACTCCCGGGCCGACCCGACTCGCTCATC
CTGCAGGAGCTGCGGCGCCAAGATGAGTGGAGAGGAGAACCCAGCCAGCAAGCCCACGCC
GGTGCAGGACGTACAGGGCGACGGGCGCTGGATGTCCCTGCACCATCGGTTCGTGGCTGA
CAGCAAAGATAAGGAACCCGAAGTCGTCTTCATCGGGGACTCCTTGGTCCAGCTCATGCA
CCAGTGCGAGATCTGGCGCGAGCTCTTCTCTCCTCTGCATGCACTTAACTTTGGCATTGG
TGGTGACGGCACACAGCATGTACTGTGGCGGCTGGAGAATGGGGAGCTGGAACACATCCG
GCCCAAGATTGTGGTGGTCTGGGTGGGCACCAACAACCACGGACACACAGCAGAGCAGGT
GACTGGTGGCATCAAGGCCATTGTGCAACTGGTGAATGAGCGACAGCCCCAGGCCCGGGT
TGTGGTGCTGGGCCTGCTTCCGCGAGGCCAACATCCCAACCCACTTCGGGAGAAGAACCG
ACAGGTGAACGAGCTGGTACGGGCGGCACTGGCTGGCCACCCTCGGGCCCACTTCCTAGA
TGCCGACCCTGGCTTTGTGCACTCAGATGGCACCATCAGCCATCATGACATGTATGATTA
CCTGCATCTGAGCCGCCTGGGCTACACACCTGTTTGCCGGGCTCTGCACTCCCTGCTTCT
GCGTCTGCTGGCCCAAGACCAGGGCCAAGGTGCTCCCCTGCTGGAGCCCGCACCCTAAGC
ATCCTGCTGCCTTCCCACAACATTAAACTCTCCTTCCTCAGTGAAAAAAAAAAAAAAAAA
A
Restriction Sites Please inquire     
ACCN NM_001145939
Insert Size 1000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001145939.1, NP_001139411.1
RefSeq Size 1108 bp
RefSeq ORF 696 bp
Locus ID 5050
Cytogenetics 19q13.2
Protein Families Druggable Genome
Protein Pathways Ether lipid metabolism, Metabolic pathways
Gene Summary 'This gene encodes an acetylhydrolase that catalyzes the removal of an acetyl group from the glycerol backbone of platelet-activating factor. The encoded enzyme is a subunit of the platelet-activating factor acetylhydrolase isoform 1B complex, which consists of the catalytic beta and gamma subunits and the regulatory alpha subunit. This complex functions in brain development. A translocation between this gene on chromosome 19 and the CDC-like kinase 2 gene on chromosome 1 has been observed, and was associated with cognitive disability, ataxia, and atrophy of the brain. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]'
Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2 and 3 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.