ABH2 (ALKBH2) (NM_001145374) Human Untagged Clone

CAT#: SC326457

ALKBH2 (untagged)-Human alkB, alkylation repair homolog 2 (E. coli) (ALKBH2), transcript variant 1, mRNA


  "NM_001145374" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ALKBH2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ALKBH2
Synonyms ABH2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001145374, the custom clone sequence may differ by one or more nucleotides


ATGGACAGATTCCTGGTGAAAGGGGCTCAAGGGGGCCTTTTGAGGAAGCAGGAGGAGCAAGAGCCAACTG
GAGAAGAGCCAGCTGTGTTGGGAGGAGACAAAGAAAGCACAAGGAAGAGGCCCAGGAGAGAGGCCCCAGG
GAATGGAGGCCACTCAGCAGGCCCTAGCTGGCGGCACATTCGGGCTGAGGGCCTGGACTGCAGTTACACA
GTCCTGTTTGGCAAAGCTGAGGCAGATGAGATTTTCCAAGAGTTGGAGAAAGAAGTAGAATATTTTACAG
GAGCACTGGCCAGAGTCCAGGTATTCGGGAAGTGGCACAGTGTGCCCAGGAAGCAGGCAACGTATGGCGA
CGCTGGGCTGACCTACACATTTTCAGGCCTCACGCTGTCTCCAAAGCCCTGGATCCCAGTTCTAGAGCGC
ATCCGGGATCACGTCTCTGGGGTGACTGGACAGACCTTCAACTTTGTGCTCATCAACAGGTATAAAGATG
GCTGTGACCACATCGGGGAGCACCGAGATGATGAAAGAGAACTGGCCCCTGGGAGCCCCATTGCCTCTGT
CTCCTTCGGTGCCTGCAGAGACTTTGTCTTCCGGCATAAGGATTCCCGTGGGAAAAGCCCCTCCAGGAGG
GTGGCGGTGGTCAGGCTGCCGCTGGCCCACGGGAGCTTACTAATGATGAACCACCCGACCAACACGCACT
GGTACCACAGTCTTCCCGTGAGAAAGAAGGTTCTGGCTCCACGGGTGAATCTGACTTTTCGTAAAATTTT
GCTTACTAAAAAATAA


Restriction Sites SgfI-MluI     
ACCN NM_001145374
ORF Size 786 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001145374.1, NP_001138846.1
RefSeq Size 1206
RefSeq ORF 786
Locus ID 121642
Protein Families Druggable Genome
Gene Summary The Escherichia coli AlkB protein protects against the cytotoxicity of methylating agents by repair of the specific DNA lesions generated in single-stranded DNA. ALKBH2 and ALKBH3 (MIM 610603) are E. coli AlkB homologs that catalyze the removal of 1-methyladenine and 3-methylcytosine (Duncan et al., 2002 [PubMed 12486230]). [supplied by OMIM, Mar 2008]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1-3 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.