ABH2 (ALKBH2) (NM_001145374) Human Untagged Clone
CAT#: SC326457
ALKBH2 (untagged)-Human alkB, alkylation repair homolog 2 (E. coli) (ALKBH2), transcript variant 1, mRNA
"NM_001145374" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ALKBH2 |
Synonyms | ABH2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001145374, the custom clone sequence may differ by one or more nucleotides
ATGGACAGATTCCTGGTGAAAGGGGCTCAAGGGGGCCTTTTGAGGAAGCAGGAGGAGCAAGAGCCAACTG GAGAAGAGCCAGCTGTGTTGGGAGGAGACAAAGAAAGCACAAGGAAGAGGCCCAGGAGAGAGGCCCCAGG GAATGGAGGCCACTCAGCAGGCCCTAGCTGGCGGCACATTCGGGCTGAGGGCCTGGACTGCAGTTACACA GTCCTGTTTGGCAAAGCTGAGGCAGATGAGATTTTCCAAGAGTTGGAGAAAGAAGTAGAATATTTTACAG GAGCACTGGCCAGAGTCCAGGTATTCGGGAAGTGGCACAGTGTGCCCAGGAAGCAGGCAACGTATGGCGA CGCTGGGCTGACCTACACATTTTCAGGCCTCACGCTGTCTCCAAAGCCCTGGATCCCAGTTCTAGAGCGC ATCCGGGATCACGTCTCTGGGGTGACTGGACAGACCTTCAACTTTGTGCTCATCAACAGGTATAAAGATG GCTGTGACCACATCGGGGAGCACCGAGATGATGAAAGAGAACTGGCCCCTGGGAGCCCCATTGCCTCTGT CTCCTTCGGTGCCTGCAGAGACTTTGTCTTCCGGCATAAGGATTCCCGTGGGAAAAGCCCCTCCAGGAGG GTGGCGGTGGTCAGGCTGCCGCTGGCCCACGGGAGCTTACTAATGATGAACCACCCGACCAACACGCACT GGTACCACAGTCTTCCCGTGAGAAAGAAGGTTCTGGCTCCACGGGTGAATCTGACTTTTCGTAAAATTTT GCTTACTAAAAAATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001145374 |
ORF Size | 786 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001145374.1, NP_001138846.1 |
RefSeq Size | 1206 |
RefSeq ORF | 786 |
Locus ID | 121642 |
Protein Families | Druggable Genome |
Gene Summary | The Escherichia coli AlkB protein protects against the cytotoxicity of methylating agents by repair of the specific DNA lesions generated in single-stranded DNA. ALKBH2 and ALKBH3 (MIM 610603) are E. coli AlkB homologs that catalyze the removal of 1-methyladenine and 3-methylcytosine (Duncan et al., 2002 [PubMed 12486230]). [supplied by OMIM, Mar 2008] Transcript Variant: This variant (1) represents the longest transcript. Variants 1-3 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226507 | ALKBH2 (Myc-DDK-tagged)-Human alkB, alkylation repair homolog 2 (E. coli) (ALKBH2), transcript variant 1 |
USD 420.00 |
|
RG226507 | ALKBH2 (GFP-tagged) - Human alkB, alkylation repair homolog 2 (E. coli) (ALKBH2), transcript variant 1 |
USD 460.00 |
|
RC226507L3 | Lenti ORF clone of Human alkB, alkylation repair homolog 2 (E. coli) (ALKBH2), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC226507L4 | Lenti ORF clone of Human alkB, alkylation repair homolog 2 (E. coli) (ALKBH2), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review