TXNDC5 (NM_001145549) Human Untagged Clone

CAT#: SC326461

TXNDC5 (untagged)-Human thioredoxin domain containing 5 (endoplasmic reticulum) (TXNDC5), transcript variant 3, mRNA


  "NM_001145549" in other vectors (4)

Reconstitution Protocol

USD 660.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "TXNDC5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TXNDC5
Synonyms ENDOPDI; ERP46; HCC-2; HCC2; PDIA15; STRF8; UNQ364
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001145549, the custom clone sequence may differ by one or more nucleotides
ATGGAAGATGCCAAAGTCTATGTGGCTAAAGTGGACTGCACGGCCCACTCCGACGTGTGC
TCCGCCCAGGGGGTGCGAGGATACCCCACCTTAAAGCTTTTCAAGCCAGGCCAAGAAGCT
GTGAAGTACCAGGGTCCTCGGGACTTCCAGACACTGGAAAACTGGATGCTGCAGACACTG
AACGAGGAGCCAGTGACACCAGAGCCGGAAGTGGAACCGCCCAGTGCCCCCGAGCTCAAG
CAAGGGCTGTATGAGCTCTCAGCAAGCAACTTTGAGCTGCACGTTGCACAAGGCGACCAC
TTTATCAAGTTCTTCGCTCCGTGGTGTGGTCACTGCAAAGCCCTGGCTCCAACCTGGGAG
CAGCTGGCTCTGGGCCTTGAACATTCCGAAACTGTCAAGATTGGCAAGGTTGATTGTACA
CAGCACTATGAACTCTGCTCCGGAAACCAGGTTCGTGGCTATCCCACTCTTCTCTGGTTC
CGAGATGGGAAAAAGGTGGATCAGTACAAGGGAAAGCGGGATTTGGAGTCACTGAGGGAG
TACGTGGAGTCGCAGCTGCAGCGCACAGAGACTGGAGCGACGGAGACCGTCACGCCCTCA
GAGGCCCCGGTGCTGGCAGCTGAGCCCGAGGCTGACAAGGGCACTGTGTTGGCACTCACT
GAAAATAACTTCGATGACACCATTGCAGAAGGAATAACCTTCATCAAGTTTTATGCTCCA
TGGTGTGGTCATTGTAAGACTCTGGCTCCTACTTGGGAGGAACTCTCTAAAAAGGAATTC
CCTGGTCTGGCGGGGGTCAAGATCGCCGAAGTAGACTGCACTGCTGAACGGAATATCTGC
AGCAAGTATTCGGTACGAGGCTACCCCACGTTATTGCTTTTCCGAGGAGGGAAGAAAGTC
AGTGAGCACAGTGGAGGCAGAGACCTTGACTCGTTACACCGCTTTGTCCTGAGCCAAGCG
AAAGACGAACTT
Restriction Sites Please inquire     
ACCN NM_001145549
ORF Size 3195 bp
Insert Size 3195
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001145549.1, NP_001139021.1
RefSeq Size 3195
RefSeq ORF 3195
Locus ID 81567
Protein Families Druggable Genome
Gene Summary This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal endoplasmic reticulum (ER)-signal sequence, three catalytically active thioredoxin domains and a C-terminal ER-retention sequence. Its expression is induced by hypoxia and its role may be to protect hypoxic cells from apoptosis. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring upstream BLOC1S5 gene. [provided by RefSeq, Dec 2016]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region and uses a downstream start codon, compared to variant 1. The resulting isoform (3) is shorter at the N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.