GALP (NM_001145546) Human Untagged Clone

CAT#: SC326517

GALP (untagged)-Human galanin-like peptide (GALP), transcript variant 2, mRNA

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GALP
• Synonyms: alarin (splice variant); galanin-like peptide
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001145546, the custom clone sequence may differ by one or more nucleotides
  ATGGCTCCTCCCTCCGTCCCCCTGGTCCTCCTCCTCGTCCTCTTGCTGAGCCTGGCAGAG
  ACTCCAGCATCCGCACCTGCCCACCGGTCCTCCACCTTCCCCAAATGGGTGACCAAGACG
  GAAAGAGGGAGACAGCCCTTGAGATCC
  
• Restriction Sites: Please inquire
• ACCN: NM_001145546
• ORF Size: 150 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001145546.1, NP_001139018.1
• RefSeq Size: 889
• RefSeq ORF: 150
• Locus ID: 85569
• Protein Families: Secreted Protein
• Gene Summary: This gene encodes a member of the galanin family of neuropeptides. The encoded protein binds galanin receptors 1, 2 and 3 with the highest affinity for galanin receptor 3 and has been implicated in biological processes involving the central nervous system including hypothalamic regulation of metabolism and reproduction. A peptide encoded by a splice variant of this gene, termed alarin, has vasoactive properties, displays antimicrobial activity against E. coli, and may serve as a marker for neuroblastic tumors. [provided by RefSeq, Nov 2014]
  Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift and an early stop codon compared to variant 1. The encoded isoform (2) has a distinct and shorter C-terminus compared to isoform 1. This variant, termed alarin, is a candidate for nonsense-mediated mRNA decay (NMD) but is being represented as protein-coding based on evidence supporting the transcript and protein described in PMID 16954604. The exon structure of this variant is based on Figure 1 from PMID 16954604.