HOPX (NM_001145460) Human Untagged Clone

CAT#: SC326528

HOPX (untagged)-Human HOP homeobox (HOPX), transcript variant 5, mRNA


  "NM_001145460" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "HOPX"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HOPX
Synonyms CAMEO; HOD; HOP; LAGY; NECC1; OB1; SMAP31; TOTO
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001145460, the custom clone sequence may differ by one or more nucleotides
ATGCTCATTTTCCTGGGCTGTTACAGAAGAAGACTGGAAGAGCGCGCAGGGACCATGTCG
GCGGAGACCGCGAGCGGCCCCACAGAGGACCAGGTGGAAATCCTGGAGTACAACTTCAAC
AAGGTCGACAAGCACCCGGATTCCACCACGCTGTGCCTCATCGCGGCCGAGGCAGGCCTT
TCCGAGGAGGAGACCCAGGGTAGTGATTTGATCTCCAGGAGCAAAATATGGCACCCAGAA
AGTAGCCCCCAAAGAGAAGGCTACCCCCATGATAGTCTGCCGTGCTTGGCTTTCGATTAC
TTTTCTCTACTGCCGCCCCAGTGTAAAGAAATGGTT
Restriction Sites Please inquire     
ACCN NM_001145460
ORF Size 339 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001145460.1, NP_001138932.1
RefSeq Size 1682
RefSeq ORF 339
Locus ID 84525
Protein Families Transcription Factors
Gene Summary The protein encoded by this gene is a homeodomain protein that lacks certain conserved residues required for DNA binding. It was reported that choriocarcinoma cell lines and tissues failed to express this gene, which suggested the possible involvement of this gene in malignant conversion of placental trophoblasts. Studies in mice suggest that this protein may interact with serum response factor (SRF) and modulate SRF-dependent cardiac-specific gene expression and cardiac development. Multiple alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Feb 2009]
Transcript Variant: This variant (5) includes an alternate exon in the 3' coding region that results in a frameshift, compared to variant 1. The encoded isoform (c) has a distinct C-terminus and is longer than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.