PGAP2 (NM_001145439) Human Untagged Clone

CAT#: SC326530

PGAP2 (untagged)-Human FGF receptor activating protein 1 (FRAG1), transcript variant 3, mRNA

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PGAP2
• Synonyms: CWH43-N; FLJ26520; FRAG1; MGC799
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001145439, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTAGATGGAACGCAGCTGAGAGGTGCCCAATTACCTGCCCTCGGTGAGCTCAGCCATCGGCGGGGAG
  GTGCCCCAGCGCTACGTGTGGCGTTTCTGCATCGGCCTGCACTCGGCGCCTCGCTTCTTGGTGGCCTTCG
  CCTACTGGAACCACTACCTCAGCTGCACCTCCCCGTGTTCCTGCTATCGCCCGCTCTGCCGCCTCAACTT
  CGGCCTCAATGTCGTGGAGAACCTCGCGTTGCTAGTGCTCACTTATGTCTCCTCCTCCGAGGACTTCACC
  ATCCACGAAAATGCTTTCATTGTGTTCATTGCCTCATCCCTCGGGCACATGCTCCTCACCTGCATTCTCT
  GGCGGTTGACCAAGAAGCACACAGTAAGTCAGGAGGATCGCAAGTCCTACAGCTGGAAACAGCGGCTCTT
  CATCATCAACTTCATCTCCTTCTTCTCGGCGCTGGCTGTCTACTTTCGGCACAACATGTATTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001145439
• ORF Size: 486 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001145439.1, NP_001138911.1
• RefSeq Size: 1607
• RefSeq ORF: 486
• Locus ID: 27315
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: The protein encoded by this gene plays a role in the maturation of glycosylphosphatidylinositol (GPI) anchors on GPI-anchored proteins. Mutations in this gene are associated with an autosomal recessive syndrome characterized by hyperphosphatasia and intellectual disability. [provided by RefSeq, Jul 2017]
  Transcript Variant: This variant (3)omits an alternate in-frame coding exon, and represents use of an alternate promoter that results in inclusion of alternate exons, compared to variant 1. This extends the open reading frame resulting in a distinct N-terminus represented in isoform 3.