SAE1 (NM_001145714) Human Untagged Clone

CAT#: SC326542

SAE1 (untagged)-Human SUMO1 activating enzyme subunit 1 (SAE1), transcript variant 3, mRNA


  "NM_001145714" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SAE1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SAE1
Synonyms AOS1; HSPC140; SUA1; UBLE1A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001145714, the custom clone sequence may differ by one or more nucleotides


ATGGTGGAGAAGGAGGAGGCTGGCGGCGGCATTAGCGAGGAGGAGGCGGCACAGTATGACCGGCAGATCC
GCCTGTGGGGACTGGAGGCCCAGAAACGGCTGCGGGCCTCTCGGGTGCTTCTTGTCGGCTTGAAAGGACT
TGGGGCTGAAATTGCCAAGAATCTCATCTTGGCAGGAGTGAAAGGACTGACCATGCTGGATCACGAACAG
GTAACTCCAGAAGATCCCGGAGCTCAGTTCTTGATTCGTACTGGGTCTGTTGGCCGAAATAGGGCTGAAG
CCTCTTTGGAGCGAGCTCAGAATCTCAACCCCATGGTGGATGTGAAGGTGGACACTGAGGATATAGAGAA
GAAACCAGAGTCATTTTTCACTCAATTCGATGCTGTGTGTCTGACTTGCTGCTCCAGGGATGTCATAGTT
AAAGTTGACCAGATCTGTCACAAAAATAGCATCAAGTTCTTTACAGGAGATGTTTTTGGCTACCATGGAT
ACACATTTGCCAATCTAGGAGAGCATGAGTTTGTAGAGGAGAAAACTAAAGTTGCCAAAGTTAGCCAAGG
AGTAGAAGATGGGCCCGACACCAAGAGAGCAAAACTTGATTCTTCTGAGACAACGATGGTCAAAAAGAAG
GTGGTCTTCTGCCCTGTTAAAGAAGCCCTGGAGGTGGACTGGAGCAGTGAGAAAGCAAAGGCTGCTCTGA
AGCGCACGACCTCCGACTACTTTCTCCTTCAAGGTACTGCTTCTCCGAGATGGCCCCAGTGTGTGCGGTG
GTTGGAGGGATTTTGGCACAGGAAATTGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001145714
ORF Size 801 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001145714.1, NP_001139186.1
RefSeq Size 2393
RefSeq ORF 801
Locus ID 10055
Protein Pathways Ubiquitin mediated proteolysis
Gene Summary Posttranslational modification of proteins by the addition of the small protein SUMO (see SUMO1; MIM 601912), or sumoylation, regulates protein structure and intracellular localization. SAE1 and UBA2 (MIM 613295) form a heterodimer that functions as a SUMO-activating enzyme for the sumoylation of proteins (Okuma et al., 1999 [PubMed 9920803]). [supplied by OMIM, Mar 2010]
Transcript Variant: This variant (3) lacks an alternate exon, compared to variant 1, which causes a frameshift. The resulting protein (isoform b) has a distinct C-terminus and is shorter than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.