BAFF (TNFSF13B) (NM_001145645) Human Untagged Clone
CAT#: SC326543
TNFSF13B (untagged)-Human tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13B), transcript variant 2, mRNA
"NM_001145645" in other vectors (4)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | TNFSF13B |
| Synonyms | BAFF; BLYS; CD257; DTL; TALL-1; TALL1; THANK; TNFSF20; TNLG7A; ZTNF4 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001145645, the custom clone sequence may differ by one or more nucleotides
ATGGATGACTCCACAGAAAGGGAGCAGTCACGCCTTACTTCTTGCCTTAAGAAAAGAGAA GAAATGAAACTGAAGGAGTGTGTTTCCATCCTCCCACGGAAGGAAAGCCCCTCTGTCCGA TCCTCCAAAGACGGAAAGCTGCTGGCTGCAACCTTGCTGCTGGCACTGCTGTCTTGCTGC CTCACGGTGGTGTCTTTCTACCAGGTGGCCGCCCTGCAAGGGGACCTGGCCAGCCTCCGG GCAGAGCTGCAGGGCCACCACGCGGAGAAGCTGCCAGCAGGAGCAGGAGCCCCCAAGGCC GGCCTGGAGGAAGCTCCAGCTGTCACCGCGGGACTGAAAATCTTTGAACCACCAGCTCCA GGAGAAGGCAACTCCAGTCAGAACAGCAGAAATAAGCGTGCCGTTCAGGGTCCAGAAGAA ACAGGATCTTACACATTTGTTCCATGGCTTCTCAGCTTTAAAAGGGGAAGTGCCCTAGAA GAAAAAGAGAATAAAATATTGGTCAAAGAAACTGGTTACTTTTTTATATATGGTCAGGTT TTATATACTGATAAGACCTACGCCATGGGACATCTAATTCAGAGGAAGAAGGTCCATGTC TTTGGGGATGAATTGAGTCTGGTGACTTTGTTTCGATGTATTCAAAATATGCCTGAAACA CTACCCAATAATTCCTGCTATTCAGCTGGCATTGCAAAACTGGAAGAAGGAGATGAACTC CAACTTGCAATACCAAGAGAAAATGCACAAATATCACTGGATGGAGATGTCACATTTTTT GGTGCATTGAAACTGCTG |
| Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
| Restriction Sites | Please inquire |
| ACCN | NM_001145645 |
| ORF Size | 801 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Reference Data | |
| RefSeq | NM_001145645.1, NP_001139117.1 |
| RefSeq Size | 1147 |
| RefSeq ORF | 801 |
| Locus ID | 10673 |
| Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
| Protein Pathways | Cytokine-cytokine receptor interaction |
| Gene Summary | The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for receptors TNFRSF13B/TACI, TNFRSF17/BCMA, and TNFRSF13C/BAFFR. This cytokine is expressed in B cell lineage cells, and acts as a potent B cell activator. It has been also shown to play an important role in the proliferation and differentiation of B cells. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2011] Transcript Variant: This variant (2) omits an in-frame coding exon, compared to variant 1, resulting in a shorter protein (isoform 2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227189 | TNFSF13B (Myc-DDK-tagged)-Human tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13B), transcript variant 2 |
USD 420.00 |
|
| RG227189 | TNFSF13B (GFP-tagged) - Human tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13B), transcript variant 2 |
USD 460.00 |
|
| RC227189L3 | Lenti ORF clone of Human tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13B), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
| RC227189L4 | Lenti ORF clone of Human tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13B), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China
