PGAP2 (NM_001145438) Human Untagged Clone

CAT#: SC326554

PGAP2 (untagged)-Human FGF receptor activating protein 1 (FRAG1), transcript variant 2, mRNA

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PGAP2
• Synonyms: CWH43-N; FRAG1; HPMRS3; MRT17; MRT21
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001145438, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTAGATTGGGAAGCACCGGCGGGGTGTCGGGAAGGGTGGTGACGCAACATAGAGACTCCGCCCCCT
  TCCTTGGAGCGCCGCGACTCGGGCTGAGGGAGCTCGGGCCAATCAGAGGGACGGCCCCAGAATGGCATGG
  TAGATGGAACGCAGCTGAGAGGTCTGACAAGATGTACCAGGTCCCACTACCACTGGATCGGGATGGGACC
  CTGGTACGGCTCCGCTTCACCATGGTGGCCCTGGTCACGGTCTGCTGTCCACTTGTCGCCTTCCTCTTCT
  GCATCCTCTGGTCCCTGCTCTTCCACTTCAAGGAGACAACGGCCACACACTGTGGGGTGCCCAATTACCT
  GCCCTCGGTGAGCTCAGCCATCGGCGGGGAGGTGCCCCAGCGCTACGTGTGGCGTTTCTGCATCGGCCTG
  CACTCGGCGCCTCGCTTCTTGGTGGCCTTCGCCTACTGGAACCACTACCTCAGCTGCACCTCCCCGTGTT
  CCTGCTATCGCCCGCTCTGCCGCCTCAACTTCGGCCTCAATGTCGTGGAGAACCTCGCGTTGCTAGTGCT
  CACTTATGTCTCCTCCTCCGAGGACTTCACCATCCACGAAAATGCTTTCATTGTGTTCATTGCCTCATCC
  CTCGGGCACATGCTCCTCACCTGCATTCTCTGGCGGTTGACCAAGAAGCACACAGATCGCAAGTCCTACA
  GCTGGAAACAGCGGCTCTTCATCATCAACTTCATCTCCTTCTTCTCGGCGCTGGCTGTCTACTTTCGGCA
  CAACATGTATTGTGAGGCTGGAGTGTACACCATCTTTGCCATCCTGGAGTACACTGTTGTCTTAACCAAC
  ATGGCGTTCCACATGACGGCCTGGTGGGACTTCGGGAACAAGGAGCTGCTCATAACCTCTCAGCCTGAGG
  AAAAGCGATTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001145438
• ORF Size: 924 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001145438.2, NP_001138910.1
• RefSeq Size: 1876
• RefSeq ORF: 924
• Locus ID: 27315
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: The protein encoded by this gene plays a role in the maturation of glycosylphosphatidylinositol (GPI) anchors on GPI-anchored proteins. Mutations in this gene are associated with an autosomal recessive syndrome characterized by hyperphosphatasia and intellectual disability. [provided by RefSeq, Jul 2017]
  Transcript Variant: This variant (2) contains alternate 5' exon structure and thus differs in the 5' UTR and 5' coding region, lacks an alternate in-frame exon in the central coding region, and uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The encoded isoform (2) has a distinct and longer N-terminus but is overall shorter than isoform 1.