HOMER3 (NM_001145724) Human Untagged Clone

CAT#: SC326559

HOMER3 (untagged)-Human homer homolog 3 (Drosophila) (HOMER3), transcript variant 4, mRNA

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HOMER3
• Synonyms: HOMER-3; VESL3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001145724, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCACAGCCAGGGAGCAGCCAATCTTCAGCACACGGGCGCACGTGTTCCAAATTGACCCAGCCACCA
  AGCGAAACTGGATCCCAGCGGGCAAGCACGCACTCACTGTCTCCTATTTCTACGATGCCACCCGCAATGT
  GTACCGCATCATCAGCATCGGAGGCGCCAAGGCCATCATCAACAGCACTGTCACTCCCAACATGACCTTC
  ACCAAAACTTCCCAGAAGTTCGGGCAGTGGGCCGACAGTCGCGCCAACACAGTCTACGGCCTGGGCTTTG
  CCTCTGAACAGCATCTGACACAGGTGCCCCCGAGCCCTCTCGTCAGTGCCAACGGCCCCGGCGAGGAAAA
  ACTGTTCCGCAGCCAGAGCGCTGATGCCCCCGGCCCCACAGAGCGCGAGCGGCTAAAGAAGATGTTGTCT
  GAGGGCTCCGTGGGCGAGGTACAGTGGGAGGCCGAGTTTTTCGCACTGCAGGACAGCAACAACAAGCTGG
  CAGGCGCCCTGCGAGAGGCCAACGCCGCCGCAGCCCAGTGGAGGCAGCAGCTGGAGGCTCAGCGTGCAGA
  GGCCGAGCGGCTGCGGCAGCGGGTGGCTGAGCTGGAGGCTCAGGCAGCTTCAGAGGTGACCCCCACCGGT
  GAGAAGGAGGGGCTGGGCCAGGGCCAGTCGCTGGAACAGCTGGAAGCTCTGGTGCAAACCAAGGACCAGG
  AGATTCAGACCCTGAAGAGTCAGACTGGGGGGCCCCGCGAGGCCCTGGAGGCTGCCGAGCGTGAGGAGAC
  TCAGCAGAAGGTGCAGGACCTGGAGACCCGCAATGCGGAGTTGGAGCACCAGCTGCGGGCGATGGAGCGC
  AGCCTGGAGGAGGCACGGGCAGAGCGGGAGCGGGCGCGGGCTGAGGTGGGCCGGGCAGCGCAGCTGCTGG
  ACGTCAGCCTGTTTGAGCTGAGTGAGCTGCGTGAGGGCCTGGCCCGCCTGGCTGAGGCTGCGCCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001145724
• ORF Size: 978 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001145724.1, NP_001139196.1
• RefSeq Size: 1297
• RefSeq ORF: 978
• Locus ID: 9454
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a member of the HOMER family of postsynaptic density scaffolding proteins that share a similar domain structure consisting of an N-terminal Enabled/vasodilator-stimulated phosphoprotein homology 1 domain which mediates protein-protein interactions, and a carboxy-terminal coiled-coil domain and two leucine zipper motifs that are involved in self-oligomerization. The encoded protein binds numerous other proteins including group I metabotropic glutamate receptors, inositol 1,4,5-trisphosphate receptors and amyloid precursor proteins and has been implicated in diverse biological functions such as neuronal signaling, T-cell activation and trafficking of amyloid beta peptides. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
  Transcript Variant: This variant (4), termed Homer-3B00, differs in the 5' UTR and lacks an exon in the coding region, compared to variant 1, but maintains the reading frame. The encoded isoform (3) is shorter than isoform 1.