HRH4 (NM_001160166) Human Untagged Clone

CAT#: SC326659

HRH4 (untagged)-Human histamine receptor H4 (HRH4) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HRH4
• Synonyms: AXOR35; BG26; GPCR105; GPRv53; H4; H4R; HH4R
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001160166, the custom clone sequence may differ by one or more nucleotides
  ATGCCAGATACTAATAGCACAATCAATTTATCACTAAGCACTCGTGTTACTTTAGCATTT
  TTTATGTCCTTAGTAGCTTTTGCTATAATGCTAGGAAATGCTTTGGTCATTTTAGCTTTT
  GTGGTGGACAAAAACCTTAGACATCGAAGTAGTTATTTTTTTCTTAACTTGGCCATCTCT
  GACTTCTTTGTGGGTGTCTTA
  
• Restriction Sites: Please inquire
• ACCN: NM_001160166
• ORF Size: 204 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001160166.1, NP_001153638.1
• RefSeq Size: 3522
• RefSeq ORF: 204
• Locus ID: 59340
• Protein Families: Druggable Genome, GPCR, Transmembrane
• Protein Pathways: Neuroactive ligand-receptor interaction
• Gene Summary: Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by a family of histamine receptors, which are a subset of the G-protein coupled receptor superfamily. This gene encodes a histamine receptor that is predominantly expressed in haematopoietic cells. The protein is thought to play a role in inflammation and allergy reponses. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
  Transcript Variant: This variant (3) lacks an alternate coding exon resulting in a frameshift, compared to variant 1. The resulting isoform (3), also known as H4R(67), has a substantially shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.