PET117 (NM_001164811) Human Untagged Clone

CAT#: SC326663

PET117 (untagged)-Human cytochrome c oxidase assembly factor-like (PET117)


  "NM_001164811" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "PET117"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PET117
Synonyms CSRP2BP
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001164811 edited
ATGTCTAGGAGCTCGAAGGTGGTGCTGGGCCTCTCGGTGCTGCTGACGGCGGCCACAGTG
GCCGGCGTACATGTGAAGCAGCAGTGGGACCAGCAGAGGCTTCGTGACGGAGTTATCAGA
GACATTGAGAGGCAAATTCGGAAAAAAGAAAACATTCGTCTTTTGGGAGAACAGATTATT
TTGACTGAGCAACTTGAAGCAGAAAGAGAGAAGATGTTATTGGCAAAAGGATCTCAAAAA
TCATGA
Restriction Sites Please inquire     
ACCN NM_001164811
ORF Size 246 bp
Insert Size 700
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001164811.1, NP_001158283.1
RefSeq Size 1174
RefSeq ORF 246
Locus ID 100303755

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.