ASXL1 (NM_001164603) Human Untagged Clone

CAT#: SC326665

ASXL1 (untagged)-Human additional sex combs like 1 (Drosophila) (ASXL1) transcript variant 2


  "NM_001164603" in other vectors (6)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ASXL1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ASXL1
Synonyms BOPS; MDS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001164603, the custom clone sequence may differ by one or more nucleotides


ATGAAGGACAAACAGAAGAAGAAGAAGGAGCGCACGTGGGCCGAGGCCGCGCGCCTGGTATTAGAAAACT
ACTCGGATGCTCCAATGACACCAAAACAGATTCTGCAGGTCATAGAGGCAGAAGGACTAAAGGAAATGAG
AAGTGGGACTTCCCCTCTCGCATGCCTCAATGCTATGCTACATTCCAATTCAAGAGGAGGAGAGGGGTTG
TTTTATAAACTGCCTGGCCGAATCAGCCTTTTCACGCTCAAGGTGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001164603
ORF Size 258 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001164603.1, NP_001158075.1
RefSeq Size 1084
RefSeq ORF 258
Locus ID 171023
Gene Summary This gene is similar to the Drosophila additional sex combs gene, which encodes a chromatin-binding protein required for normal determination of segment identity in the developing embryo. The protein is a member of the Polycomb group of proteins, which are necessary for the maintenance of stable repression of homeotic and other loci. The protein is thought to disrupt chromatin in localized areas, enhancing transcription of certain genes while repressing the transcription of other genes. The protein encoded by this gene functions as a ligand-dependent co-activator for retinoic acid receptor in cooperation with nuclear receptor coactivator 1. Mutations in this gene are associated with myelodysplastic syndromes and chronic myelomonocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Transcript Variant: This variant (2) differs in the 3' UTR and lacks several exons in the 3' coding region, but contains an alternate 3' exon, compared to variant 1. The encoded isoform (2) is significantly shorter and has a distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.