ASXL1 (NM_001164603) Human Untagged Clone
CAT#: SC326665
ASXL1 (untagged)-Human additional sex combs like 1 (Drosophila) (ASXL1) transcript variant 2
"NM_001164603" in other vectors (6)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | ASXL1 |
| Synonyms | BOPS; MDS |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001164603, the custom clone sequence may differ by one or more nucleotides
ATGAAGGACAAACAGAAGAAGAAGAAGGAGCGCACGTGGGCCGAGGCCGCGCGCCTGGTATTAGAAAACT ACTCGGATGCTCCAATGACACCAAAACAGATTCTGCAGGTCATAGAGGCAGAAGGACTAAAGGAAATGAG AAGTGGGACTTCCCCTCTCGCATGCCTCAATGCTATGCTACATTCCAATTCAAGAGGAGGAGAGGGGTTG TTTTATAAACTGCCTGGCCGAATCAGCCTTTTCACGCTCAAGGTGTGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001164603 |
| ORF Size | 258 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Reference Data | |
| RefSeq | NM_001164603.1, NP_001158075.1 |
| RefSeq Size | 1084 |
| RefSeq ORF | 258 |
| Locus ID | 171023 |
| Gene Summary | This gene is similar to the Drosophila additional sex combs gene, which encodes a chromatin-binding protein required for normal determination of segment identity in the developing embryo. The protein is a member of the Polycomb group of proteins, which are necessary for the maintenance of stable repression of homeotic and other loci. The protein is thought to disrupt chromatin in localized areas, enhancing transcription of certain genes while repressing the transcription of other genes. The protein encoded by this gene functions as a ligand-dependent co-activator for retinoic acid receptor in cooperation with nuclear receptor coactivator 1. Mutations in this gene are associated with myelodysplastic syndromes and chronic myelomonocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009] Transcript Variant: This variant (2) differs in the 3' UTR and lacks several exons in the 3' coding region, but contains an alternate 3' exon, compared to variant 1. The encoded isoform (2) is significantly shorter and has a distinct C-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228030 | ASXL1 (Myc-DDK-tagged)-Human additional sex combs like 1 (Drosophila) (ASXL1), transcript variant 2 |
USD 150.00 |
|
| RG228030 | ASXL1 (GFP-tagged) - Human additional sex combs like 1 (Drosophila) (ASXL1), transcript variant 2 |
USD 460.00 |
|
| RC228030L1 | Lenti ORF clone of Human additional sex combs like 1 (Drosophila) (ASXL1), transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
| RC228030L2 | Lenti ORF clone of Human additional sex combs like 1 (Drosophila) (ASXL1), transcript variant 2, mGFP tagged |
USD 620.00 |
|
| RC228030L3 | Lenti ORF clone of Human additional sex combs like 1 (Drosophila) (ASXL1), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
| RC228030L4 | Lenti ORF clone of Human additional sex combs like 1 (Drosophila) (ASXL1), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China