LYRM4 (NM_001164841) Human Untagged Clone

CAT#: SC326672

LYRM4 (untagged)-Human LYR motif containing 4 (LYRM4) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LYRM4
• Synonyms: C6orf149; CGI-203; COXPD19; ISD11
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001164841, the custom clone sequence may differ by one or more nucleotides
  ATGGCAGCCTCCAGTCGCGCACAAGTGTTATCTCTGTACCGGGCGATGCTGAGAGAGAGC
  AAGCGTTTCAGCGCCTACAATTACAGAACATATGCTGTCAGGAGGATAAGAGATGCCTTC
  AGAGAAAATAAAAATGTAAAGGATCCTGTAGAAATTCAAACCCTAGTGAATAAAGCCAAG
  AGAGACCTTGGAGTAATTCGTCGACAGGTAGCTGAGCAAGGCACAGCCGCCAGGAGGAAG
  TCGGGGAACAGCAGCCGGAGCCTGGGGAAGCCCTGCACAAGTTGGCCT
  
• Restriction Sites: Please inquire
• ACCN: NM_001164841
• ORF Size: 291 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001164841.1, NP_001158313.1
• RefSeq Size: 1626
• RefSeq ORF: 291
• Locus ID: 57128
• Gene Summary: The protein encoded by this gene is found in both mitochondria and the nucleus, where it binds cysteine desulfurase and helps free inorganic sulfur for Fe/S clusters. Disruption of this gene negatively impacts mitochondrial and cytosolic iron homeostasis. [provided by RefSeq, Sep 2016]
  Transcript Variant: This variant (3) includes an additional exon that results in an alternate 3' coding region and 3' UTR compared to variant 1. The encoded isoform (3) has a distinct, longer C-terminus compared to isoform 1.