BANF2 (NM_001159495) Human Untagged Clone

CAT#: SC326673

BANF2 (untagged)-Human barrier to autointegration factor 2 (BANF2) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BANF2
• Synonyms: BAF-L; BAF2; BAFL; C20orf179
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001159495, the custom clone sequence may differ by one or more nucleotides
  ATGCTGCGAGGAACAAAGGAGATGGACAACATGTCTCCCAGGCTGAGAGCCTTCCTCTCC
  GAACCCATTGGAGAAAAGGATGTCTGCTGGGTGGATGGCATCAGCCATGAGCTCGCGATC
  AATTTGGTCACCAAAGGTATCAATAAGGCCTACATCCTGCTGGGACAATTCCTTCTGATG
  CACAAGAATGAAGCCGAGTTTCAGAGGTGGCTCATTTGCTGTTTTGGTGCCACTGAGTGT
  GAGGCCCAGCAGACTTCTCACTGCCTCAAGGAGTGGTGTGCCTGCTTCCTG
  
• Restriction Sites: Please inquire
• ACCN: NM_001159495
• ORF Size: 294 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001159495.1, NP_001152967.1
• RefSeq Size: 390
• RefSeq ORF: 294
• Locus ID: 140836
• Gene Summary: May play a role in BANF1 regulation and influence tissue-specific roles of BANF1. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) uses an alternate 5' exon and an upstream in-frame start codon, compared to variant 1. The resulting isoform (2) has a longer N-terminus compared to isoform 1.