RPAIN (NM_001160246) Human Untagged Clone

CAT#: SC326682

RPAIN (untagged)-Human RPA interacting protein (RPAIN) transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RPAIN
• Synonyms: HRIP; RIP
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001160246, the custom clone sequence may differ by one or more nucleotides
  ATGGCGGAGTCGTTGAGGTCTCCGCGCCGCTCCCTGTACAAACTGGTGGGCTCGCCGCCT
  TGGAAAGAGGCTTTCCGGCAGAGATGCCTGGAGAGAATGAGAAACAGCCGGGACAGGCTC
  CTAAACAGGTACCGCCAGGCTGGAAGCAGTGGGCCAGGGAATTCTCAGAACAGCTTTCTA
  GTTCAAGAGGTGATGGAAGAAGAGTGGAATGCTTTGCAGTCAGTGGAGAATTGTCCAGAA
  GACTTGGCTCAGCTGGAGGAGCTGATAGACATGGCTGTGCTGGAGGAAATTCAACAGGAG
  CTGATCAACCAAGGCCTG
  
• Restriction Sites: Please inquire
• ACCN: NM_001160246
• ORF Size: 321 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001160246.1, NP_001153718.1
• RefSeq Size: 1362
• RefSeq ORF: 321
• Locus ID: 84268
• Gene Summary: Mediates the import of RPA complex into the nucleus, possibly via some interaction with importin beta. Isoform 2 is sumoylated and mediates the localization of RPA complex into the PML body of the nucleus, thereby participating in RPA function in DNA metabolism. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) differs in the 3' UTR and has multiple coding region differences compared to variant 1. This results in a shorter isoform (d) with a distinct C-terminus, compared to isoform a.