Lymphocyte Antigen 6 Complex (LY6K) (NM_001160354) Human Untagged Clone

CAT#: SC326695

LY6K (untagged)-Human lymphocyte antigen 6 complex locus K (LY6K) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LY6K
• Synonyms: CT97; HSJ001348; ly-6K; URLC10
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001160354, the custom clone sequence may differ by one or more nucleotides
  ATGGCGCTGCTCGCCTTGCTGCTGGTCGTGGCCCTACCGCGGGTGTGGACAGACGCCAAC
  CTGACTGCGAGACAACGAGATCCAGAGGACTCCCAGCGAACGGACGAGGGTGACAATAGA
  GTGTGGTGTCATGTTTGTGAGAGAGAAAACACTTTCGAGTGCCAGAACCCAAGGAGGTGC
  AAATGGACAGAGCCATACTGCGTTATAGCGGCCGTGACAACCCCTAGACCCGCATTCCCA
  GTGCATATGGACAGGCCATACCACGCAGAAGCCAGCCCTTCCCTGAAGCAGCATTCAACA
  CACAGGCCTGGCCCTCGTCCTCCCGACTCCCCCTTGGTGCCCCAGTTGACTGTGCACCTT
  
• Restriction Sites: Please inquire
• ACCN: NM_001160354
• ORF Size: 363 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001160354.1, NP_001153826.1
• RefSeq Size: 1994
• RefSeq ORF: 363
• Locus ID: 54742
• Protein Families: Transmembrane