ABCB5 (NM_001163993) Human Untagged Clone

CAT#: SC326700

ABCB5 (untagged)-Human ATP-binding cassette sub-family B (MDR/TAP) member 5 (ABCB5) transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ABCB5
• Synonyms: ABCB5alpha; ABCB5beta; EST422562
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001163993, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTGGATGAGAATGACATCAGAGCTTTAAATGTGCGGCATTATCGAGACCATATTGGAGTGGTTAGTC
  AAGAGCCTGTTTTGTTCGGGACCACCATCAGTAACAATATCAAGTATGGACGAGATGATGTGACTGATGA
  AGAGATGGAGAGAGCAGCAAGGGAAGCAAATGCGTATGATTTTATCATGGAGTTTCCTAATAAATTTAAT
  ACATTGGTAGGGGAAAAAGGAGCTCAAATGAGTGGAGGGCAGAAACAGAGGATCGCAATTGCTCGTGCCT
  TAGTTCGAAACCCCAAGATTCTGATTTTAGATGAGGCTACGTCTGCCCTGGATTCAGAAAGCAAGTCAGC
  TGTTCAAGCTGCACTGGAGAAGAAAAAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001163993
• ORF Size: 381 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001163993.2, NP_001157465.1
• RefSeq Size: 1724
• RefSeq ORF: 381
• Locus ID: 340273
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: ABC transporters
• Gene Summary: ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]). [supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (4) differs in the 5' and 3' UTRs and has multiple coding region differences, compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (4) with a shorter N-terminus and a shorter and distinct C-terminus, compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.