ZNF268 (NM_001165887) Human Untagged Clone

CAT#: SC326701

ZNF268 (untagged)-Human zinc finger protein 268 (ZNF268) transcript variant 9

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ZNF268
• Synonyms: HZF3
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001165887, the custom clone sequence may differ by one or more nucleotides
  ATGGCCACCAGGGTCCGGACAGCTTCTATTTGGGGACCTTTGTCATTCATGGATGTGTTT
  GTGGATTTTACCTGGGAGGAGTGGCAGCTGCTAGACCCAGCACAGAAGTGCCTGTACAGG
  AGTGTGATGTTGGAGAACTATAGCAACCTGGTGTCCCTAGGGTACCAACACACCAAACCT
  GATATCATCTTCAAGTTGGAACAAGGAGAAGAGCTGTGTATGGTGCAGGCCCAAGTTCCA
  AATCAGACCTGTCCAATTTTGAAGGCTGGAAAGTCCAAAGCCAAGGTGCTGGCAGGTTTG
  GTGTCTGGTGAGGGCCTGCTCTGTGCTTCCAAGATGACGCCTTGTTGCTGCATCCTCTGG
  AGACACAGTCTGGAAAAT
  
• Restriction Sites: Please inquire
• ACCN: NM_001165887
• ORF Size: 381 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001165887.1, NP_001159359.1
• RefSeq Size: 5661
• RefSeq ORF: 381
• Locus ID: 10795
• Protein Families: Transcription Factors
• Gene Summary: Isoform 2: Contributes to cervical carcinogenesis in part through the TNF-alpha-induced NF-kappa-B signaling pathway by interacting with the I-kappa-B-kinase (IKK) core complex. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (9) lacks an alternate in-frame exon and contains an alternate coding exon, which causes a frameshift compared to variant 1. The resulting isoform (h) lacks an internal segment and has a shorter and distinct C-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.