ABCB5 (NM_001163942) Human Untagged Clone

CAT#: SC326706

ABCB5 (untagged)-Human ATP-binding cassette sub-family B (MDR/TAP) member 5 (ABCB5) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ABCB5
• Synonyms: ABCB5alpha; ABCB5beta; EST422562
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001163942, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTGGATGAGAATGACATCAGAGCTTTAAATGTGCGGCATTATCGAGACCATATTGGAGTGGTTAGTC
  AAGAGCCTGTTTTGTTCGGGACCACCATCAGTAACAATATCAAGTATGGACGAGATGATGTGACTGATGA
  AGAGATGGAGAGAGCAGCAAGGGAAGCAAATGCGTATGATTTTATCATGGAGTTTCCTAATAAATTTAAT
  ACATTGGTAGGGGAAAAAGGAGCTCAAATGAGTGGAGGGCAGAAACAGAGGATCGCAATTGCTCGTGCCT
  TAGTTCGAAACCCCAAGATTCTGATTTTAGATGAGGCTACGTCTGCCCTGGATTCAGAAAGCAAGTCAGC
  TGTTCAAGCTGCACTGGAGAAGGATACCCCCAGGTATTCATTTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001163942
• ORF Size: 396 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001163942.1, NP_001157414.1
• RefSeq Size: 2247
• RefSeq ORF: 396
• Locus ID: 340273
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: ABC transporters
• Gene Summary: ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]). [supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (3) differs in the 5' and 3' UTRs and has multiple coding region differences, compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (3) with a shorter N-terminus and a shorter and distinct C-terminus, compared to variant 1. This variant (3) is the mRNA isoform alpha as described in PMID 15760339.